miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006498
Located between position 11745661 and 11745766 on chromosome 10 strand +
mature miRNAs for MI0006498:
         vvi-miR160c (MIMAT0005653): TGCCTGGCTCCCTGTATGCCA
You can find this miRNA in ENTREZGENE: MIR160C (accession: 100272010)

References
[1]Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro, Nature. 449:463-467(2007)., "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"
[2]Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS, BMC Genomics. 10:558(2009)., "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"