| Basic information from miRBase |
| hairpin accession number: MI0015370 |
| Located between position 15368653 and 15368760 on chromosome 8 strand - |
| mature miRNAs for MI0015370: |
| vvi-miR2111 (MIMAT0016364): TAATCTGCATCCTGAGGTCTA |
| vvi-miR2111* (MIMAT0016365): GTCCTCTGGTTGCAGATTACT |
| References |
| [1]Hsieh LC, Lin SI, Shih AC, Chen JW, Lin WY, Tseng CY, Li WH, Chiou TJ, Plant Physiol. 151:2120-2132(2009)., "Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing" |