| Basic information from miRBase |
| hairpin accession number: MI0016017 |
| Located between position 2139190 and 2139391 on chromosome 8 strand + |
| mature miRNAs for MI0016017: |
| vvi-miR3624* (MIMAT0018011): TAGTATGCTGCTGTCTTTAGA |
| vvi-miR3624 (MIMAT0018012): TCAGGGCAGCAGCATACTACT |
| References |
| [1]Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J, Plant J. 62:960-976(2010)., "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" |