| Basic information from miRBase |
| hairpin accession number: MI0016022 |
| Located between position 18253988 and 18254169 on chromosome 13 strand + |
| mature miRNAs for MI0016022: |
| vvi-miR3629a* (MIMAT0018021): CGCATTTTCTCAGCAGCCAAG |
| vvi-miR3629a (MIMAT0018022): GGCTGCTGAGAAAATGTAGGA |
| References |
| [1]Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J, Plant J. 62:960-976(2010)., "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" |