| Basic information from miRBase |
| hairpin accession number: MI0016023 |
| Located between position 3031525 and 3031629 on chromosome 14 strand + |
| mature miRNAs for MI0016023: |
| vvi-miR3629b (MIMAT0018023): GGCTGCTGAGAAAATGTAGGA |
| References |
| [1]Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J, Plant J. 62:960-976(2010)., "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" |