| Basic information from miRBase |
| hairpin accession number: MI0016028 |
| Located between position 6430141 and 6430304 on chromosome 5 strand + |
| mature miRNAs for MI0016028: |
| vvi-miR3631b (MIMAT0018031): CATGTTGACATCATCCAATATA |
| vvi-miR3631b* (MIMAT0018032): TGTTGGATGATGTCAATAAGT |
| References |
| [1]Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J, Plant J. 62:960-976(2010)., "Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis" |