| Basic information from miRBase |
| hairpin accession number: MI0011279 |
| Located between position 689 and 770 on chromosome AZM5_29209 strand + |
| mature miRNAs for MI0011279: |
| zma-miR2275b-5p (MIMAT0011769): AGGATTAGAGGCAACTGAACC |
| zma-miR2275b-3p (MIMAT0011770): TTCAGTTTCCTCTAATATCTCA |
| References |
| [1]Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH, Genome Res. 19:1429-1440(2009)., "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" |