| Basic information from miRBase |
| hairpin accession number: MI0013200 |
| Located between position 826 and 926 on chromosome AZM5_39868 strand + |
| mature miRNAs for MI0013200: |
| zma-miR169m (MIMAT0013989): TAGCCAAGAATGGCTTGCCTA |
| zma-miR169m* (MIMAT0015324): GGCATCCATTCTTGGCTAAG |
| References |
| [1]Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D, PLoS Genet. 5:e1000716(2009)., "A genome-wide characterization of microRNA genes in maize" |