miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011277
mature miRNAs for MI0011277:
         zma-miR2118g (MIMAT0011766): TTCCTGATGCCTCCTATTCCTA

References
[1]Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH, Genome Res. 19:1429-1440(2009)., "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"