RetrogeneDB ID:

retro_hsap_15

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:6:28227149..28228358(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000189134
Aliases:NKAPL, C6orf194, bA424I5.1
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:NKAP
Ensembl ID:ENSG00000101882
Aliases:None
Description:NFKB activating protein [Source:HGNC Symbol;Acc:29873]


Retrocopy-Parental alignment summary:






>retro_hsap_15
ATGCCCCCAGTATCCCGGTCCAGCTATTCCGAGGACATCGTGGGCTCTCGGAGAAGGCGACGCAGCTCCTCGGGGAGCCC
ACCATCCCCGCAGAGCAGATGTTCCTCTTGGGATGGCTGTTCCCGCTCTCACTCCCGCGGCCGTGAGGGCCTCAGGCCTC
CTTGGAGTGAGTTGGACGTGGGCGCTCTTTACCCCTTTAGTCGCTCTGGGTCGCGAGGGCGGCTCCCAAGATTCCGCAAC
TACGCCTTCGCGTCCTCCTGGTCGACCTCGTATAGTGGATATCGCTACCATCGTCACTGCTATGCAGAAGAACGGCAGTC
AGCGGAAGACTACGAGAAGGAAGAGAGCCATCGGCAGAGGAGGCTGAAGGAGAGAGAGAGGATTGGGGAATTGGGAGCGC
CTGAAGTGTGGGGGCCGTCTCCAAAGTTCCCTCAGCTAGATTCTGACGAACATACCCCAGTTGAGGATGAAGAAGAGGTA
ACGCATCAGAAAAGCAGCAGTTCAGATTCCAACTCGGAAGAACATAGGAAAAAGAAGACCAGTCGTTCAAGAAACAAGAA
AAAAAGAAAGAATAAGTCGTCTAAAAGAAAGCATAGGAAATATTCTGATAGTGACAGTAACTCAGAGTCTGACACAAATT
CTGACTCTGATGATGATAAAAAGAGAGTTAAAGCCAAGAAGAAAAAGAAGAAAAAGAAACACAAAACAAAGAAAAAGAAG
AATAAGAAAACCAAAAAAGAATCCAGTGACTCAAGCTGTAAAGACTCAGAAGAGGACTTGTCAGAAGCTACCTGGATGGA
GCAGCCAAATGTGGCAGATACTATGGATTTAATAGGGCCAGAAGCACCTATAATACATACCTCTCAAGATGAAAAACCTT
TGAAGTATGGCCATGCTTTGCTTCCCGGTGAAGGTGCAGCTATGGCTGAGTATGTAAAAGCTGGAAAGCGAATCCCACGA
AGAGGTGAAATTGGGTTGACAAGTGAAGAGATCGGTTCTTTTGAATGCTCAGGTTATGTCATGAGTGGTAGCAGGCATCG
CAGAATGGAGGCTGTACGACTGCGTAAGGAGAACCAGATCTACAGTGCTGATGAGAAGAGAGCTCTTGCATCCTTTAACC
AAGAAGAGAGACGAAAGAGAGAAAGTAAGATTTTAGCCAGTTTCCGAGAGATGGTGCACAAAAAGACAAAAGAGAAAGAT
GACAAGTAA

ORF - retro_hsap_15 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 69.1 %
Parental protein coverage: 81.93 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalSRSRSRERPSAPRGIPFASASSSVYYGSYSRPYGSDKPWPSLLDKEREESLRQKRLSERERIGELGAPEV
SRS.SR.R....R...FAS..S..Y.G.............S..D.E.EES.RQ.RL.ERERIGELGAPEV
RetrocopySRSGSRGRLPRFRNYAFASSWSTSYSGYRYHRHCYAEERQSAEDYEKEESHRQRRLKERERIGELGAPEV
ParentalWGLSPKNPEPDSDEHTPVEDEEP---KKSTTSASTSEEEKKKKSSRSKERSKKRRKKKSSKRKHKKYSED
WG.SPK.P..DSDEHTPVEDEE.....KS..S.S.SEE..KKK.SRS..R.KK.RK.KSSKRKH.KYS.D
RetrocopyWGPSPKFPQLDSDEHTPVEDEEEVTHQKSSSSDSNSEEHRKKKTSRS--RNKKKRKNKSSKRKHRKYS-D
ParentalSDSDSDSETDSSDEDNKRRAKKAKKKEKKKKHRSKKYKKKRSKKSRKESSDSSSKESQEEFLENPWKDRT
SDS.S.S.T.S...D.K.R.K.AKKK.KKKKH.....KKK..KK..KESSDSS.K.S.E...E..W....
RetrocopySDSNSESDTNSDSDDDKKRVK-AKKKKKKKKHKT---KKKKNKKTKKESSDSSCKDSEEDLSEATWMEQP
ParentalKAEEPSDLIGPEAPKTLTSQDDKPLNYGHALLPGEGAAMAEYVKAGKRIPRRGEIGLTSEEIASFECSGY
......DLIGPEAP...TSQD.KPL.YGHALLPGEGAAMAEYVKAGKRIPRRGEIGLTSEEI.SFECSGY
RetrocopyNVADTMDLIGPEAPIIHTSQDEKPLKYGHALLPGEGAAMAEYVKAGKRIPRRGEIGLTSEEIGSFECSGY
ParentalVMSGSRHRRMEAVRLRKENQIYSADEKRALASFNQEERRKRENKILASFREMVYRKTKGKDDK
VMSGSRHRRMEAVRLRKENQIYSADEKRALASFNQEERRKRE.KILASFREMV..KTK.KDDK
RetrocopyVMSGSRHRRMEAVRLRKENQIYSADEKRALASFNQEERRKRESKILASFREMVHKKTKEKDDK

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 2 .33 RPM 12 .90 RPM
bodymap2_adrenal 1 .64 RPM 16 .38 RPM
bodymap2_brain 2 .11 RPM 17 .72 RPM
bodymap2_breast 4 .57 RPM 11 .87 RPM
bodymap2_colon 2 .55 RPM 16 .32 RPM
bodymap2_heart 1 .88 RPM 6 .66 RPM
bodymap2_kidney 1 .63 RPM 13 .75 RPM
bodymap2_liver 0 .13 RPM 10 .22 RPM
bodymap2_lung 0 .18 RPM 11 .27 RPM
bodymap2_lymph_node 0 .49 RPM 14 .24 RPM
bodymap2_ovary 1 .60 RPM 20 .72 RPM
bodymap2_prostate 2 .30 RPM 16 .44 RPM
bodymap2_skeletal_muscle 5 .37 RPM 9 .40 RPM
bodymap2_testis 43 .27 RPM 19 .19 RPM
bodymap2_thyroid 4 .69 RPM 14 .20 RPM
bodymap2_white_blood_cells 0 .28 RPM 17 .36 RPM
RNA Polymerase II activity may be related with retro_hsap_15 in 4 libraries
ENCODE library ID Target ChIP-Seq Peak coordinates
ENCFF002CHO POLR2A 6:28226873..28227222
ENCFF002CQI POLR2A 6:28226824..28227260
ENCFF002CQM POLR2A 6:28226747..28227227
ENCFF002CQO POLR2A 6:28226821..28227351
34 EST(s) were mapped to retro_hsap_15 retrocopy
EST ID Start End Identity Match Mis-match Score
AA193476 28227267 28227825 99.1 540 2 531
AA426031 28227497 28227826 100 329 0 329
AA719187 28227448 28227827 100 378 0 377
AA889640 28227347 28227703 99.8 354 1 352
AA993479 28227394 28227706 99.7 311 1 310
AI633740 28227369 28227827 99.8 457 1 456
AI825371 28227451 28227827 100 376 0 376
AI825424 28227566 28227856 99 290 0 289
AI970107 28227290 28227827 98.7 533 4 528
AI989981 28227300 28227827 99.7 525 2 523
AI129164 28227396 28227835 100 438 0 437
AI183972 28227359 28227833 100 474 0 474
AJ574107 28227325 28227696 99.8 370 1 369
AW003978 28227238 28227827 99.7 587 2 585
AW196436 28227357 28227827 98.8 469 1 466
AW207887 28227306 28227835 99.7 524 2 519
AW515746 28227326 28227827 99.9 500 1 499
BE042106 28227473 28227714 99.2 230 2 226
BF061938 28227363 28227827 99 459 5 454
BF222720 28227311 28227827 99.9 515 1 514
BF592882 28227224 28227827 97.2 588 13 571
BQ186305 28227168 28227714 99.5 542 0 541
BQ186490 28227177 28227805 99.6 626 0 625
BX115857 28227115 28227764 99.9 647 1 646
CK299257 28227168 28227714 99.9 542 1 541
DB454384 28227091 28227560 99.8 468 1 467
DB471905 28227074 28227570 99.8 495 1 494
DB473910 28227074 28227561 99.6 485 2 483
DB478241 28227074 28227566 99.6 490 2 488
EL737170 28227149 28227795 99.7 641 2 639
H86864 28227745 28228025 97.5 279 0 276
HY019101 28227157 28227608 100 451 0 451
HY202334 28227467 28227872 98.8 401 2 398
W78197 28227097 28227526 98.6 420 2 410


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr ≤ 1 1 < Expr ≤ 5 5 < Expr ≤ 10 Expr > 10
TSS #1 TSS_163202897 libraries 253 libraries 539 libraries 111 libraries 29 libraries
TSS #2 TSS_1632031620 libraries 196 libraries 11 libraries 2 libraries 0 libraries

The graphical summary, for retro_hsap_15 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

retro_hsap_15 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_15 has 5 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Pan troglodytes retro_ptro_117
Pongo abelii retro_pabe_198
Macaca mulatta retro_mmul_121
Mus musculus retro_mmus_279
Rattus norvegicus retro_rnor_93

Parental genes homology:
Parental genes homology involve 15 parental genes, and 15 retrocopies.

Species Parental gene accession Retrocopies number
Canis familiaris ENSCAFG000000184331 retrocopy
Dasypus novemcinctus ENSDNOG000000000721 retrocopy
Echinops telfairi ENSETEG000000010071 retrocopy
Felis catus ENSFCAG000000043921 retrocopy
Homo sapiens ENSG00000101882 1 retrocopy
retro_hsap_15 ,
Loxodonta africana ENSLAFG000000029621 retrocopy
Macaca mulatta ENSMMUG000000123821 retrocopy
Mus musculus ENSMUSG000000164091 retrocopy
Nomascus leucogenys ENSNLEG000000149221 retrocopy
Otolemur garnettii ENSOGAG000000010041 retrocopy
Pongo abelii ENSPPYG000000206791 retrocopy
Pan troglodytes ENSPTRG000000222331 retrocopy
Rattus norvegicus ENSRNOG000000311691 retrocopy
Sus scrofa ENSSSCG000000126131 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000011341 retrocopy

Expression level across human populations :

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Undefined variable $populLEGEND in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM

Fatal error: Uncaught Error: Call to undefined function mysql_query() in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php:3390 Stack trace: #0 /home/rosikiewicz/RetrogeneDB2/BETA/retrogene.php(1158): include() #1 {main} thrown in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3390