RetrogeneDB ID:

retro_hsap_19

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:9:38395745..38397299(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000137124
Aliases:ALDH1B1, ALDH5, ALDHX
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:ALDH2
Ensembl ID:ENSG00000111275
Aliases:ALDH2, ALDH-E2, ALDHI, ALDM
Description:aldehyde dehydrogenase 2 family (mitochondrial) [Source:HGNC Symbol;Acc:404]


Retrocopy-Parental alignment summary:






>retro_hsap_19
ATGCTGCGCTTCCTGGCACCCCGGCTGCTTAGCCTCCAGGGCAGGACCGCCCGCTACTCCTCGGCAGCAGCCCTCCCAAG
CCCCATTCTGAACCCAGACATCCCCTACAACCAGCTGTTCATCAACAATGAATGGCAAGATGCAGTCAGCAAGAAGACCT
TCCCGACGGTCAACCCTACCACCGGGGAGGTCATTGGGCACGTGGCTGAAGGTGACCGGGCTGATGTGGATCGGGCCGTG
AAAGCAGCCCGGGAAGCCTTCCGCCTGGGGTCCCCATGGCGCCGGATGGATGCCTCTGAGCGGGGCCGGCTGCTGAACCG
CCTGGCAGACCTAGTGGAGCGGGATCGAGTCTACTTGGCCTCACTCGAGACCTTGGACAATGGGAAGCCTTTCCAAGAGT
CTTACGCCTTGGACTTGGATGAGGTCATCAAGGTGTATCGGTACTTTGCTGGCTGGGCTGACAAGTGGCATGGCAAGACC
ATCCCCATGGATGGCCAGCATTTCTGCTTCACCCGGCATGAGCCCGTTGGTGTCTGTGGCCAGATCATCCCGTGGAACTT
CCCCTTGGTCATGCAGGGTTGGAAACTTGCCCCGGCACTCGCCACAGGCAACACTGTGGTTATGAAGGTGGCAGAGCAGA
CCCCCCTCTCTGCCCTGTATTTGGCCTCCCTCATCAAGGAGGCAGGCTTTCCCCCTGGGGTGGTGAACATCATCACGGGG
TATGGCCCAACAGCAGGTGCGGCCATCGCCCAGCACGTGGATGTTGACAAAGTTGCCTTCACCGGTTCCACCGAGGTGGG
CCACCTGATCCAGAAAGCAGCTGGCGATTCCAACCTCAAGAGAGTCACCCTGGAGCTGGGTGGTAAGAGCCCCAGCATCG
TGCTGGCCGATGCTGACATGGAGCATGCCGTGGAGCAGTGCCACGAAGCCCTGTTCTTCAACATGGGCCAGTGCTGCTGT
GCTGGCTCCCGGACCTTCGTGGAAGAATCCATCTACAATGAGTTTCTCGAGAGAACCGTGGAGAAAGCAAAGCAGAGGAA
AGTGGGGAACCCCTTTGAGCTGGACACCCAGCAGGGGCCTCAGGTGGACAAGGAGCAGTTTGAACGAGTCCTAGGCTACA
TCCAGCTTGGCCAGAAGGAGGGCGCAAAACTCCTCTGTGGCGGAGAGCGTTTCGGGGAGCGTGGTTTCTTCATCAAGCCT
ACTGTCTTTGGTGGCGTGCAGGATGACATGAGAATTGCCAAAGAGGAGATCTTTGGGCCTGTGCAGCCCCTGTTCAAGTT
CAAGAAGATTGAGGAGGTGGTTGAGAGGGCCAACAACACCAGGTATGGCCTGGCTGCGGCTGTGTTCACCCGGGATCTGG
ACAAGGCCATGTACTTCACCCAGGCACTCCAGGCCGGGACCGTGTGGGTAAACACCTACAACATCGTCACCTGCCACACG
CCATTTGGAGGGTTTAAGGAATCTGGAAACGGGAGGGAGCTGGGTGAGGATGGGCTTAAGGCCTACACAGAGGTAAAGAC
GGTCACCATCAAGGTTCCTCAGAAGAACTCGTAA

ORF - retro_hsap_19 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 72.73 %
Parental protein coverage: 100.0 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalMLRAAARFGPRLGRRLLSAAATQAVPAPNQQPEVFCNQIFINNEWHDAVSRKTFPTVNPSTGEVICQVAE
MLR..A.....L..R........A.P.P...P....NQ.FINNEW.DAVS.KTFPTVNP.TGEVI..VAE
RetrocopyMLRFLAPRLLSLQGRTARYSSAAALPSPILNPDIPYNQLFINNEWQDAVSKKTFPTVNPTTGEVIGHVAE
ParentalGDKEDVDKAVKAARAAFQLGSPWRRMDASHRGRLLNRLADLIERDRTYLAALETLDNGKPYVISYLVDLD
GD..DVD.AVKAAR.AF.LGSPWRRMDAS.RGRLLNRLADL.ERDR.YLA.LETLDNGKP...SY..DLD
RetrocopyGDRADVDRAVKAAREAFRLGSPWRRMDASERGRLLNRLADLVERDRVYLASLETLDNGKPFQESYALDLD
ParentalMVLKCLRYYAGWADKYHGKTIPIDGDFFSYTRHEPVGVCGQIIPWNFPLLMQAWKLGPALATGNVVVMKV
.V.K..RY.AGWADK.HGKTIP.DG..F..TRHEPVGVCGQIIPWNFPL.MQ.WKL.PALATGN.VVMKV
RetrocopyEVIKVYRYFAGWADKWHGKTIPMDGQHFCFTRHEPVGVCGQIIPWNFPLVMQGWKLAPALATGNTVVMKV
ParentalAEQTPLTALYVANLIKEAGFPPGVVNIVPGFGPTAGAAIASHEDVDKVAFTGSTEIGRVIQVAAGSSNLK
AEQTPL.ALY.A.LIKEAGFPPGVVNI..G.GPTAGAAIA.H.DVDKVAFTGSTE.G..IQ.AAG.SNLK
RetrocopyAEQTPLSALYLASLIKEAGFPPGVVNIITGYGPTAGAAIAQHVDVDKVAFTGSTEVGHLIQKAAGDSNLK
ParentalRVTLELGGKSPNIIMSDADMDWAVEQAHFALFFNQGQCCCAGSRTFVQEDIYDEFVERSVARAKSRVVGN
RVTLELGGKSP.I...DADM..AVEQ.H.ALFFN.GQCCCAGSRTFV.E.IY.EF.ER.V..AK.R.VGN
RetrocopyRVTLELGGKSPSIVLADADMEHAVEQCHEALFFNMGQCCCAGSRTFVEESIYNEFLERTVEKAKQRKVGN
ParentalPFDSKTEQGPQVDETQFKKILGYINTGKQEGAKLLCGGGIAADRGYFIQPTVFGDVQDGMTIAKEEIFGP
PF...T.QGPQVD..QF...LGYI..G..EGAKLLCGG.....RG.FI.PTVFG.VQD.M.IAKEEIFGP
RetrocopyPFELDTQQGPQVDKEQFERVLGYIQLGQKEGAKLLCGGERFGERGFFIKPTVFGGVQDDMRIAKEEIFGP
ParentalVMQILKFKTIEEVVGRANNSTYGLAAAVFTKDLDKANYLSQALQAGTVWVNCYDVFGAQSPFGGYKMSGS
V....KFK.IEEVV.RANN..YGLAAAVFT.DLDKA.Y..QALQAGTVWVN.Y.......PFGG.K.SG.
RetrocopyVQPLFKFKKIEEVVERANNTRYGLAAAVFTRDLDKAMYFTQALQAGTVWVNTYNIVTCHTPFGGFKESGN
ParentalGRELGEYGLQAYTEVKTVTVKVPQKNS
GRELGE.GL.AYTEVKTVT.KVPQKNS
RetrocopyGRELGEDGLKAYTEVKTVTIKVPQKNS

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 15 .66 RPM 333 .89 RPM
bodymap2_adrenal 56 .15 RPM 64 .99 RPM
bodymap2_brain 4 .73 RPM 197 .93 RPM
bodymap2_breast 13 .37 RPM 664 .35 RPM
bodymap2_colon 18 .91 RPM 256 .66 RPM
bodymap2_heart 5 .54 RPM 150 .37 RPM
bodymap2_kidney 25 .40 RPM 145 .61 RPM
bodymap2_liver 30 .54 RPM 513 .35 RPM
bodymap2_lung 9 .32 RPM 231 .14 RPM
bodymap2_lymph_node 8 .15 RPM 81 .85 RPM
bodymap2_ovary 30 .50 RPM 122 .29 RPM
bodymap2_prostate 100 .73 RPM 188 .89 RPM
bodymap2_skeletal_muscle 24 .10 RPM 84 .12 RPM
bodymap2_testis 22 .53 RPM 89 .14 RPM
bodymap2_thyroid 25 .40 RPM 145 .32 RPM
bodymap2_white_blood_cells 3 .80 RPM 124 .13 RPM
RNA Polymerase II activity near the 5' end of retro_hsap_19 was not detected
30 EST(s) were mapped to retro_hsap_19 retrocopy
EST ID Start End Identity Match Mis-match Score
AA102706 38396031 38396192 96.9 159 2 156
AA313769 38396353 38396825 99.6 468 2 465
BE886318 38395867 38396529 97.2 646 11 631
BE889631 38395889 38396605 99 689 6 675
BE890488 38395733 38396385 99.4 648 2 642
BG402530 38396032 38396721 98.2 659 7 637
BI752803 38395733 38396534 97 792 8 774
BI762845 38395733 38396468 99.1 727 4 716
BM749166 38395798 38396281 99.4 480 3 477
BP282430 38396210 38396793 99.9 582 1 581
BQ229478 38395838 38396482 96.7 632 3 617
BQ302635 38395888 38396460 99.2 565 5 558
BQ318064 38396487 38396878 96.7 385 6 376
BQ322648 38395970 38396375 99.6 402 2 399
BQ349201 38396930 38397093 100 163 0 163
BQ362402 38396013 38396236 97.8 218 5 213
BQ362472 38396578 38396833 98.5 254 1 252
BQ362545 38396578 38396812 98.8 231 3 228
BQ953419 38395851 38396599 98.8 739 8 729
CN255157 38396228 38396426 98.5 198 0 197
CN255158 38395745 38396218 99.6 471 2 469
CN255159 38395745 38396359 99.9 613 1 612
CV025636 38395745 38396358 99.2 610 2 607
CV317139 38396247 38396472 98.7 222 3 219
DA485658 38395884 38396451 99.9 566 1 565
DA518874 38396041 38396586 98.9 542 3 538
DA762256 38396038 38396594 99.9 554 1 553
DR006146 38395758 38395890 100 131 0 131
HY001477 38395733 38396218 99.6 483 2 481
HY116078 38396003 38396479 99.8 475 1 474
No TSS is located nearby retro_hsap_19 retrocopy 5' end.
retro_hsap_19 was not experimentally validated.


Parental genes homology:
Parental genes homology involve 22 parental genes, and 23 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG000000136641 retrocopy
Bos taurus ENSBTAG000000087431 retrocopy
Canis familiaris ENSCAFG000000086831 retrocopy
Equus caballus ENSECAG000000176732 retrocopies
Felis catus ENSFCAG000000220001 retrocopy
Homo sapiens ENSG00000111275 1 retrocopy
retro_hsap_19 ,
Homo sapiens ENSG000001649041 retrocopy
Gorilla gorilla ENSGGOG000000071081 retrocopy
Latimeria chalumnae ENSLACG000000117981 retrocopy
Microcebus murinus ENSMICG000000034871 retrocopy
Myotis lucifugus ENSMLUG000000170841 retrocopy
Macaca mulatta ENSMMUG000000083361 retrocopy
Mustela putorius furoENSMPUG000000022821 retrocopy
Mus musculus ENSMUSG000000294551 retrocopy
Nomascus leucogenys ENSNLEG000000000161 retrocopy
Otolemur garnettii ENSOGAG000000330931 retrocopy
Pongo abelii ENSPPYG000000049661 retrocopy
Pteropus vampyrus ENSPVAG000000131891 retrocopy
Rattus norvegicus ENSRNOG000000013441 retrocopy
Sus scrofa ENSSSCG000000098891 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000150091 retrocopy
Xenopus tropicalis ENSXETG000000209301 retrocopy

Expression level across human populations :

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2089

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2112

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2135

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2158

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2181

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2204

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2227

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2250

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2273

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2296

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2325

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2348

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2371

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2394

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2417

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2440

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2463

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2486

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2509

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2532

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2553

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2576

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2599

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2622

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2645

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2668

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2691

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2714

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2737

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2760

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2787

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2810

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2837

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2860

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2887

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2910

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2937

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2960

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 2987

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3010

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3122

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3145

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3168

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3191

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3214

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3241

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3264

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3287

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3310

Warning: Undefined variable $populationsDictCols in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3333

Warning: Undefined variable $populLEGEND in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3372

Warning: Undefined variable $populationsDict in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Warning: Trying to access array offset on value of type null in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375

Deprecated: number_format(): Passing null to parameter #1 ($num) of type float is deprecated in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM

Fatal error: Uncaught Error: Call to undefined function mysql_query() in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php:3390 Stack trace: #0 /home/rosikiewicz/RetrogeneDB2/BETA/retrogene.php(1158): include() #1 {main} thrown in /home/rosikiewicz/RetrogeneDB2/BETA/retrogene_maps.php on line 3390