miRNEST 2.0, an integrative microRNA resource :: Browse
Home
Browse miRNAs
Deep-seq predictions
Mirtrons
miRNA genes
Degradomes
Download
Upload
Contact
BROWSE PAGE
Select species and source of miRNA sequences
Plants
Animals
Viruses
Select plant species
Actinidia chinensis
Actinidia deliciosa
Actinidia eriantha
Adiantum capillus-veneris
Aegilops speltoides
Aegilops tauschii
Agrostis stolonifera
Alliaria petiolata
Allium cepa
Amborella trichopoda
Annona cherimola
Antirrhinum majus
Aquilegia caerulea
Aquilegia coerulea
Aquilegia formosa x Aquilegia pubescens
Arabidopsis arenosa
Arabidopsis cebennensis
Arabidopsis halleri
Arabidopsis lyrata
Arabidopsis thaliana
Arabis hirsuta
Arachis duranensis
Arachis hypogaea
Arachis ipaensis
Aristolochia fimbriata
Artemisia annua
Australopyrum velutinum
Avena barbata
Avena sativa
Barbarea vulgaris
Barnadesia spinosa
Beta vulgaris
Boechera stricta
Botryococcus braunii
Brachypodium distachyon
Brachypodium sylvaticum
Brassica napus
Brassica oleracea
Brassica oleracea var. alboglabra
Brassica rapa
Bruguiera gymnorhiza
Cajanus cajan
Camelina microcarpa
Capsella rubella
Capsicum annuum
Carica papaya
Carthamus tinctorius
Catharanthus roseus
Cenchrus ciliaris
Centaurea maculosa
Centaurea solstitialis
Chlamydomonas reinhardtii
Cicer arietinum
Cichorium endivia
Cichorium intybus
Citrus aurantium
Citrus clementina
Citrus clementine
Citrus reticulata
Citrus sinensis
Citrus trifoliata
Citrus unshiu
Citrus x limonia
Citrus x paradisi x Poncirus trifoliata
Coccomyxa sp. C-169
Coffea canephora
Conringia orientalis
Corylus avellana
Cryptomeria japonica
Cucumis melo subsp. melo
Cucumis sativus
Curcuma longa
Cycas rumphii
Cynara scolymus
Cynodon dactylon
Descurainia sophia
Dictyostelium discoideum
Dioscorea alata
Elaeis guineensis
Elymus wawawaiensis x Elymus lanceolatus mixed EST library
Eragrostis curvula
Erysimum cheiri
Eschscholzia californica
Eucalyptus globulus
Eucalyptus gunnii
Euonymus alatus
Euphorbia esula
Fagus sylvatica
Festuca arundinacea
Festuca glaucescens x Lolium multiflorum
Festuca pratensis
Fourraea alpina
Fragaria vesca
Fragaria x ananassa
Fraxinus excelsior
Gerbera hybrid cultivar
Ginkgo biloba
Glycine clandestina
Glycine max
Glycine soja
Glycyrrhiza uralensis
Gnetum gnemon
Gossypium arboretum
Gossypium arboreum
Gossypium herbaceum
Gossypium herbacium
Gossypium hirsutum
Gossypium raimondii
Guizotia abyssinica
Hedyotis centranthoides
Hedyotis terminalis
Helianthus annuus
Helianthus argophyllus
Helianthus ciliaris
Helianthus exilis
Helianthus paradoxus
Helianthus petiolaris
Helianthus tuberosus
Henrardia persica
Heteranthelium piliferum
Hevea brasiliensis
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Hordeum vulgare subsp. Vulgare
Humulus lupulus
Ipomoea batatas
Ipomoea nil
Jatropha curcas
Juglans hindsii x Juglans regia
Lactuca perennis
Lactuca saligna
Lactuca sativa
Lactuca serriola
Lactuca virosa
Leymus cinereus x Leymus triticoides
Limnanthes alba
Linum usitatissimum
Liriodendron tulipifera
Lolium perenne
Lotus corniculatus
Lotus japonicus
Lupinus luteus
Lycopersicon esculentum
Malcolmia maritima
Malus domestica
Manihot esculenta
Marchantia polymorpha
Medicago sativa
Medicago truncatula
Mesembryanthemum crystallinum
Mesostigma viride
Mimulus guttatus
Mimulus guttatus var. nasutus
Mimulus lewisii
Musa ABB Group
Nasturtium officinale
Nicotiana benthamiana
Nicotiana langsdorffii x Nicotiana sanderae
Nicotiana sylvestris
Nicotiana tabacum
Nuphar advena
Ocimum basilicum
Oenocarpus bataua
Oryza barthii
Oryza brachyantha
Oryza nivara
Oryza rufipogon
Oryza sativa
Panax ginseng
Panicum virgatum
Papaver somniferum
Parthenium argentatum
Paullinia cupana var. sorbilis
Pennisetum ciliare
Pennisetum glaucum
Peridictyon sanctum
Persea americana
Petunia axillaris subsp. axillaris
Petunia x hybrida
Phaseolus acutifolius
Phaseolus coccineus
Phaseolus vulgaris
Phleum pratense
Physcomitrella patens
Picea abies
Picea allspecies
Picea engelmannii x Picea glauca
Picea engelmannii x Picea sitchensis
Picea glauca
Picea sitchensis
Pinus banksiana
Pinus contorta
Pinus pinaster
Pinus taeda
Pisum sativum
Poncirus trifoliata
Populus alba x Populus tremula
Populus alba x Populus tremula var. glandulosa
Populus deltoides
Populus euphratica
Populus nigra
Populus tremula
Populus tremula x Populus alba
Populus tremula x Populus tremuloides
Populus tremuloides
Populus trichocarpa
Populus trichocarpa x Populus deltoides
Populus trichocarpa x Populus nigra
Populus x canadensis
Prunus armeniaca
Prunus persica
Prunus salicina
Pseudoroegneria spicata
Pseudotsuga menziesii var. menziesii
Quercus petraea
Quercus robur
Raphanus raphanistrum
Raphanus raphanistrum subsp. landra
Raphanus raphanistrum subsp. maritimus
Raphanus raphanistrum subsp raphanistrum
Raphanus sativus
Raphanus sativus var. oleiformis
Rehmannia glutinosa
Ricinus communis
Rorippa indica
Saccharum hybrid cultivar CoS 767
Saccharum hybrid cultivar SP70-1143
Saccharum officinarum
Saccharum spp.
Salvia miltiorrhiza
Saruma henryi
Schedonorus arundinaceus
Secale cereale
Selaginella moellendorffii
Sesamum indicum
Sibara virginica
Solanum demissum
Solanum habrochaites
Solanum lycopersicum
Solanum melongena
Solanum pennellii
Solanum torvum
Solanum tuberosum
Sorghum bicolor
Sorghum propinquum
Striga hermonthica
Tamarix hispida
Taraxacum kok-saghyz
Taraxacum officinale
Thellungiella halophila
Theobroma cacao
Thlaspi arvense
Trifolium pratense
Trifolium repens
Triphysaria pusilla
Triphysaria versicolor
Triticum aestivum
Triticum monococcum
Triticum turgidum
Triticum turgidum subsp. durum
Triticum urartu
Tropaeolum majus
Vigna unguiculata
Vitis shuttleworthii
Vitis vinifera
Volvox carteri
Welwitschia mirabilis
Zamia vazquezii
Zea mays
Zingiber officinale
Zinnia elegans
Zinnia violacea
or
Select animal species
Acropora millepora
Acropora palmata
Acyrthosiphon pisum
Aedes aegypti
Aiptasia pallida
Alvinella pompejana
Ambystoma tigrinum tigrinum
Amphimedon queenslandica
Ancylostoma caninum
Ancylostoma ceylanicum
Anemonia viridis
Anolis carolinensis
Anopheles gambiae
Anopheles stephensi
Anoplopoma fimbria
Antheraea assama
Aphis gossypii
Apis mellifera
Aplysia californica
Artemia franciscana
Ascaris suum
Astatotilapia burtoni
Ateles geoffroyi
Bicyclus anynana
Biomphalaria glabrata
Bombus terrestris
Bombyx mori
Bos indicus
Bos sp.
Bos taurus
Brachionus plicatilis
Branchiostoma floridae
Brugia malayi
Caenorhabditis brenneri
Caenorhabditis briggsae
Caenorhabditis elegans
Caenorhabditis japonica
Caenorhabditis remanei
Calanus finmarchicus
Caligus clemensi
Caligus rogercresseyi
Callinectes sapidus
Canis familiaris
Canis lupus familiaris
Capitella teleta
Capra hircus
Carcinus maenas
Cavia porcellus
Ceratitis capitata
Cerebratulus lacteus
Choristoneura fumiferana
Ciona intestinalis
Ciona savignyi
Clytia hemisphaerica
Cochliomyia hominivorax
Coregonus clupeaformis
Crassostrea gigas
Cricetulus griseus
Culex quinquefasciatus
Cynoglossus semilaevis
Cynops pyrrhogaster
Cyprinus carpio
Danaus plexippus
Danio rerio
Daphnia magna
Daphnia pulex
Dendroctonus ponderosae
Diabrotica virgifera virgifera
Dicentrarchus labrax
Dissostichus mawsoni
Drosophila ananassae
Drosophila auraria
Drosophila erecta
Drosophila grimshawi
Drosophila melanogaster
Drosophila mojavensis
Drosophila persimilis
Drosophila pseudoobscura
Drosophila sechellia
Drosophila simulans
Drosophila virilis
Drosophila willistoni
Drosophila yakuba
Echinococcus granulosus
Echinococcus multilocularis
Epiphyas postvittana
Eptatretus burgeri
Equus caballus
Eriocheir sinensis
Esox lucius
Euprymna scolopes
Fenneropenaeus chinensis
Frankliniella occidentalis
Fugu rubripes
Fundulus heteroclitus
Gadus morhua
Gallus gallus
Gammarus pulex
Gasterosteus aculeatus
Globodera rostochiensis
Glossina morsitans morsitans
Gorilla gorilla
Gryllus bimaculatus
Haematobia irritans irritans
Haliotis rufescens
Halocynthia roretzi
Heliconius melpomene
Heliothis virescens
Helobdella robusta
Heterodera glycines
Heterorhabditis bacteriophora
Hippoglossus hippoglossus
Homalodisca coagulata
Homarus americanus
Homo sapiens
Hydra magnipapillata
Hydra vulgaris
Ictalurus furcatus
Ictalurus punctatus
Ixodes scapularis
Lagothrix lagotricha
Lates calcarifer
Laupala kohalensis
Lemur catta
Lepeophtheirus salmonis
Lernaeocera branchialis
Leucoraja erinacea
Lipochromis sp. matumbi hunter
Litopenaeus vannamei
Locusta migratoria
Lonchura striata domestica
Lottia gigantea
Lumbricus rubellus
Lutzomyia longipalpis
Lymnaea stagnalis
Macaca fascicularis
Macaca mulatta
Macaca nemestrina
Macropus eugenii
Meleagris gallopavo
Meloidogyne chitwoodi
Meloidogyne hapla
Meloidogyne incognita
Metridium senile
Misgurnus anguillicaudatus
Mnemiopsis leidyi
Molgula tectiformis
Monodelphis domestica
Montastraea faveolata
Mus musculus
Mytilus californianus
Myzus persicae
Nasonia giraulti
Nasonia longicornis
Nasonia vitripennis
Nematostella vectensis
Nilaparvata lugens
Nippostrongylus brasiliensis
Oikopleura dioica
Onchocerca volvulus
Oncorhynchus mykiss
Oncorhynchus nerka
Oncorhynchus tshawytscha
Onychiurus arcticus
Oreochromis niloticus
Ornithorhynchus anatinus
Oryctolagus cuniculus
Oryzias latipes
Oscarella carmela
Osmerus mordax
Ostrinia nubilalis
Ovis aries
Pan paniscus
Pan troglodytes
Pan troglodytes verus
Papilio xuthus
Papio anubis
Paracentrotus lividus
Paralabidochromis chilotes
Paralichthys olivaceus
Patiria pectinifera
Penaeus monodon
Perca flavescens
Peregrinus maidis
Peripatopsis sedgwicki
Peromyscus maniculatus bairdii
Peromyscus polionotus subgriseus
Petrolisthes cinctipes
Petromyzon marinus
Phlebotomus papatasi
Pimephales promelas
Pleurobrachia pileus
Poecilia reticulata
Polypedilum vanderplanki
Pongo abelii
Pongo pygmaeus
Porites astreoides
Pristionchus pacificus
Psetta maxima
Ptyochromis sp. redtail sheller
Pygathrix bieti
Rana catesbeiana
Rattus norvegicus
Rhipicephalus appendiculatus
Rhipicephalus microplus
Rhodnius prolixus
Rutilus rutilus
Saccoglossus kowalevskii
Saguinus labiatus
Salmo salar
Salvelinus fontinalis
Samia cynthia ricini
Schistosoma japonicum
Schistosoma mansoni
Schmidtea mediterranea
Sebastes caurinus
Sebastes rastrelliger
Solea senegalensis
Solenopsis invicta
Spadella cephaloptera
Sparus aurata
Spodoptera frugiperda
Spodoptera littoralis
Squalus acanthias
Strigamia maritima
Strongylocentrotus purpuratus
Strongyloides ratti
Strongyloides stercoralis
Suberites domuncula
Sus scrofa
Symphalangus syndactylus
Taenia solium
Taeniopygia guttata
Takifugu rubripes
Teleopsis dalmanni
Tetranychus urticae
Tetraodon nigroviridis
Thunnus thynnus
Thymallus thymallus
Torpedo californica
Tribolium castaneum
Trichinella pseudospiralis
Trichinella spiralis
Trichoplusia ni
Trichosurus vulpecula
Tubifex tubifex
Ursus americanus
Xenopus laevis
Xenopus tropicalis
Xenoturbella bocki
or
Select a virus
Bandicoot papillomatosis carcinomatosis virus type 1
Bandicoot papillomatosis carcinomatosis virus type 2
BK polyomavirus
Bovine herpesvirus 1
Epstein Barr virus
Herpesvirus of turkeys
Herpes B virus
Herpes Simplex Virus 1
Herpes Simplex Virus 2
Human cytomegalovirus
Human immunodeficiency virus 1
Infectious laryngotracheitis virus
JC polyomavirus
Kaposi sarcoma-associated herpesvirus
Mareks disease virus
Mareks disease virus type 2
Merkel cell polyomavirus
Mouse cytomegalovirus
Mouse gammaherpesvirus 68
Rhesus lymphocryptovirus
Rhesus monkey rhadinovirus
Simian virus 40
Choose database(s)
Select all
miRNEST predictions
miRBase
PMRD
microPC
Huang et al.
Hao et al.
More search options
Keyword
*
miRNEST id
**
Show only miRNAs with:
Evidence
Targets
Additional data
E-values:
UniProt
RFAM
miRBase
PMRD
microPC
all
> 1e-5
> 1e-10
> 1e-20
> 1e-50
all
< 1e-5
< 1e-10
< 1e-20
< 1e-50
all
< 1e-5
< 1e-10
< 1e-20
< 1e-50
all
< 1e-5
< 1e-10
< 1e-20
< 1e-50
all
< 1e-5
< 1e-10
< 1e-20
< 1e-50
Close this window
and press
show miRNAs
* Keyword
can be:
miRNA name or its part, e.g. miR167
mature miRNA sequence or its part, e.g. TGGGATGAGA
** miRNEST id
: a unique id assigned to any miRNEST record, for instance
MNEST026564
You can also browse through miRNEST predictions in EST sequences
using a
taxonomic tree
.
CLICK FOR MORE SEARCH OPTIONS
Download all 1 records that meet your search criteria
Top species
Ciona intestinalis
, 1 records
1 records found
#
miRNEST id
Species
Family
Source
Mature miRNA
vs miRBase
Download
Details
1
MNEST025024
name from source:
cin-mir-4031
(
MI0015582
)
Ciona intestinalis
miRBase
ACATGTACCGTCGCTCTGGG
cin-mir-4031
:
7e-25
Download
Details