miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus, Macaca fascicularis, Papio anubis, Homo sapiens, Peromyscus maniculatus bairdii, Pongo abelii, Oryctolagus cuniculus, Macaca nemestrina, Cavia porcellus, Peromyscus polionotus subgriseus, Pan troglodytes verus, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST028346
species: Homo sapiens
miRNA family: let-7
source: miRBase, original name: hsa-let-7f-1 (MI0000067)

Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TGAGGTAGTAGATTGTATAGTT

miRNA*
CTATACAATCTATTGCCTTCCC

mismatches: 2
bulges: 0

View larger
pre-miRNA
TCAGAGTGAGGTAGTAGATTGTATAGTTGTGGGGTAGTGATTTTACCCTGTTCAGGAGATAACTATACAATCTATTGCCTTCCCTGA

dot-bracket secondary structure
((((.(..(((((((((((((((((((((((((((((.....))))))).........))))))))))))))))))))))..)))))


SIMILARITIES
miRBase mdo-let-7f-1: 3e-44

PMRD no hits

microPC no hits
UniProt no hits

RFAM let-7: 3e-38

Identical with: ppy-let-7f-1 from miRBase (MNEST030738)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, Solexa
deep sequencing data evidence

references

[1] Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V, BMC Genomics. 11 Suppl 1:S6(2010)., "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[4] Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ, Mol Cancer Res. 1:882-891(2003)., "Reduced accumulation of specific microRNAs in colorectal neoplasia"
[5] Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
[6] Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"




Liczniki na strone;