miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Homo sapiens



ABOUT THIS RECORD

ID: MNEST028389
species: Homo sapiens
miRNA family: mir-29
source: miRBase, original name: hsa-mir-29b-2 (MI0000107)

Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TAGCACCATTTGAAATCAGTGTT

miRNA*
GCTGGTTTCACATGGTGGCTTAGA

mismatches: 1
bulges: 3

View larger
pre-miRNA
GCTTCTGGAAGCTGGTTTCACATGGTGGCTTAGATTTTTCCATCTTTGTATCTAGCACCATTTGAAATCAGTGTTTTAGGAG

dot-bracket secondary structure
)(((((((((((((((((((.((((((.((.((((..............)))))))))))).)))))))))).)))))))))


SIMILARITIES
miRBase eca-mir-29b-2: 9.0E-41

PMRD no hits

microPC no hits
UniProt no hits

RFAM 9mir-29: 6.0E-27

Identical with: eca-mir-29b-2 from miRBase (MNEST026972), mml-mir-29b-2 from miRBase , mne-mir-29b from miRBase , ppy-mir-29b-2 from miRBase , ptr-mir-29b-2 from miRBase , sla-mir-29b from miRBase , cfa-mir-29b-2 from miRBase , ppa-mir-29b-2 from miRBase , ggo-mir-29b-2 from miRBase , bta-mir-29b-2 from miRBase , rno-mir-29b-2 from miRBase , mmu-mir-29b-2 from miRBase

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern

references

[1] Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[4] Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS, Dev Biol. 270:488-498(2004)., "Human embryonic stem cells express a unique set of microRNAs"




Liczniki na strone;