miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Homo sapiens



ABOUT THIS RECORD

ID: MNEST028602
species: Homo sapiens
miRNA family: mir-365
source: miRBase, original name: hsa-mir-365-2 (MI0000769)

Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TAATGCCCCTAAAAATCCTTAT

miRNA*
GAGGGACTTTCAGGGGCAGCTGT

mismatches: 5
bulges: 1

View larger
pre-miRNA
AGAGTGTTCAAGGACAGCAAGAAAAATGAGGGACTTTCAGGGGCAGCTGTGTTTTCTGACTCAGTCATAATGCCCCTAAAAATCCTTATTGTTCTTGCAG
TGTGCATCGGG


dot-bracket secondary structure
...........(.((((((((((.((((((((..(((.(((((((((((.(((....))).)))).....))))))))))..)))))))).)))))))..
))).)......



SIMILARITIES
miRBase cfa-mir-365-2: 2e-58

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-365: 4e-41

Identical with: eca-mir-365 from miRBase (MNEST027146)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, array-cloned
deep sequencing data evidence

references

[1] Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G, J Virol. 83:3333-3341(2009)., "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[4] Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M, Nature. 434:338-345(2005)., "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
[5] Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs"




Liczniki na strone;