miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus, Macaca fascicularis, Papio anubis, Homo sapiens, Peromyscus maniculatus bairdii, Pongo abelii, Oryctolagus cuniculus, Macaca nemestrina, Cavia porcellus, Peromyscus polionotus subgriseus, Pan troglodytes verus, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST028663
species: Homo sapiens
miRNA family: mir-452
source: miRBase, original name: hsa-mir-452 (MI0001733)

Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AACTGTTTGCAGAGGAAACTGA

miRNA*
AGTCTCATCTGCAAAGAAGTAA

mismatches: 6
bulges: 0

View larger
pre-miRNA
GCTAAGCACTTACAACTGTTTGCAGAGGAAACTGAGACTTTGTAACTATGTCTCAGTCTCATCTGCAAAGAAGTAAGTGCTTTGC

dot-bracket secondary structure
((.((((((((((...(.((((((((.((.((((((((...........)))))))).)).)))))))).).)))))))))).))


SIMILARITIES
miRBase mml-mir-452: 4e-43

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-452: 2e-39

Identical with: ppy-mir-452 from miRBase (MNEST031015)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, array-cloned

references

[1] Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[4] Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"
[5] Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs"




Liczniki na strone;