miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus, Macaca fascicularis, Papio anubis, Homo sapiens, Peromyscus maniculatus bairdii, Pongo abelii, Oryctolagus cuniculus, Macaca nemestrina, Cavia porcellus, Peromyscus polionotus subgriseus, Pan troglodytes verus, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST029335
species: Homo sapiens
miRNA family: miR-3179
source: miRBase, original name: hsa-mir-3179-1 (MI0014213)

Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AGAAGGGGTGAAATTTAAACGT

miRNA*
GTTTAAATTACACTCCTTCTGC

mismatches: 1
bulges: 0

View larger
pre-miRNA
CAGGATCACAGACGTTTAAATTACACTCCTTCTGCTGTGCCTTACAGCAGTAGAAGGGGTGAAATTTAAACGTCTGTGATCCTG

dot-bracket secondary structure
((((((((((((((((((((((.(((((((((((((((........))))))))))))))).))))))))))))))))))))))


SIMILARITIES
miRBase hsa-mir-3179-2: 2e-42

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-3179: 7e-39

Identical with: hsa-mir-3179-2 from miRBase (MNEST029336)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
deep sequencing data evidence

references

[1] Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK, PLoS One. 5:e9685(2010)., "Characterization of the Melanoma miRNAome by Deep Sequencing"
[2] Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH, PLoS One. 5:e9637(2010)., "Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
[3] Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"




Liczniki na strone;