ABOUT THIS RECORDspecies: Homo sapiens
source: miRBase, original name: hsa-mir-4471 (MI0016822)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TGGGAACTTAGTAGAGGTTTAA miRNA* AAACCTCTACTAAGTTTCCATG mismatches: 0 bulges: 0 |
pre-miRNA
CCAAATTTAAAACTTAAACCTCTACTAAGTTTCCATGAAAAGAACCCATGGGAACTTAGTAGAGGTTTAAGTTTTAAATTTGA
dot-bracket secondary structure
.((((((((((((((((((((((((((((((((((((.........)))))))))))))))))))))))))))))))))))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
references
[1] Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Yan Au W, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill , Blood. 116:e118-e127(2010)., "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
[2] Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
CCAAATTTAAAACTTAAACCTCTACTAAGTTTCCATGAAAAGAACCCATGGGAACTTAGTAGAGGTTTAAGTTTTAAATTTGA
dot-bracket secondary structure
.((((((((((((((((((((((((((((((((((((.........)))))))))))))))))))))))))))))))))))).
SIMILARITIES| miRBase no hits PMRD no hits microPC no hits | UniProt no hits RFAM no hits |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
references
[1] Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Yan Au W, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill , Blood. 116:e118-e127(2010)., "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
[2] Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
