miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus, Peromyscus maniculatus bairdii, Peromyscus polionotus subgriseus



ABOUT THIS RECORD

ID: MNEST032188
species: Mus musculus
miRNA family: mir-500
source: miRBase, original name: mmu-mir-500 (MI0004702)

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AATGCACCTGGGCAAGGGTTCA

miRNA*
ATCCTTGCTATCTGGGTGCTTAGTGC

mismatches: 5
bulges: 5

View larger
pre-miRNA
CTCCTCTGCTCCCCCTCTCTAATCCTTGCTATCTGGGTGCTTAGTGCTATCTCAATGCAATGCACCTGGGCAAGGGTTCAGAGAAGGTGAGC

dot-bracket secondary structure
.......((((.((.((((((((((((((...(..(((((....(((.........)))..)))))..)))))))))).))))).)).))))


SIMILARITIES
miRBase rno-mir-500: 4e-40

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-500: 3e-26

Identical with: rno-mir-500 from miRBase (MNEST032941)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, insitu, Northern, MPSS

references

[1] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
[4] Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I, Nucleic Acids Res. 34:1765-1771(2006)., "The expression profile of microRNAs in mouse embryos"
[5] Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[6] Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T, FEBS Lett. 580:2195-2200(2006)., "Identification of new central nervous system specific mouse microRNAs"




Liczniki na strone;