miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Rattus norvegicus



ABOUT THIS RECORD

ID: MNEST032222
species: Mus musculus
miRNA family: mir-598
source: miRBase, original name: mmu-mir-598 (MI0005556)

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TACGTCATCGTCGTCATCGTTA

miRNA*
GCGGTGATGCCGATGGTGCGAG

mismatches: 5
bulges: 0

View larger
pre-miRNA
GCTGATGCTGGCGGTGATGCCGATGGTGCGAGCTGAAAATGGGCTGCTACGTCATCGTCGTCATCGTTATCATCATCAT

dot-bracket secondary structure
(.(((((.(((((((((((.((((((.((.((((.......))))))....)))))).))))))))))).))))).)..


SIMILARITIES
miRBase rno-mir-598: 1e-39

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-598: 2e-38

Identical with: rno-mir-598 from miRBase (MNEST032962)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: RAKE, Solexa

references

[1] Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E, Genome Res. 16:1289-1298(2006)., "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
[2] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
[3] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[4] Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"




Liczniki na strone;