miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Mus musculus, Sus scrofa, Bos taurus, Rattus norvegicus, Canis lupus familiaris, Ovis aries, Macaca fascicularis, Papio anubis, Homo sapiens, Peromyscus maniculatus bairdii, Pongo abelii, Ursus americanus, Equus caballus, Oryctolagus cuniculus, Macaca nemestrina, Cavia porcellus, Bos indicus, Bos sp., Peromyscus polionotus subgriseus, Capra hircus, Pan troglodytes verus, Macaca mulatta



ABOUT THIS RECORD

ID: MNEST033159
species: Bos taurus
miRNA family: mir-29
source: miRBase, original name: bta-mir-29b-1 (MI0010464)

Taxonomy by NCBI:
Bos taurus Bos Bovinae Bovidae Pecora Ruminantia Cetartiodactyla Laurasiatheria Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TAGCACCATTTGAAATCAGTGTT

miRNA*
GCTGGTTTCATATGGTGGTTTAGA

mismatches: 1
bulges: 3

View larger
pre-miRNA
CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAGCACCATTTGAAATCAGTGTTCTTGGGGG

dot-bracket secondary structure
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).


SIMILARITIES
miRBase eca-mir-29b: 9e-41

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-29: 2e-26

Identical with: cfa-mir-29b-1 from miRBase (MNEST026649)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Array, qRT-PCR

references

[1] Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M, Mol Reprod Dev. 76:665-677(2009)., "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
[2] Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
[3] Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
[4] Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species"




Liczniki na strone;