miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Bombyx mori, Choristoneura fumiferana, Spodoptera frugiperda, Heliothis virescens, Antheraea assama, Spodoptera littoralis, Samia cynthia ricini, Danaus plexippus, Papilio xuthus, Ostrinia nubilalis, Trichoplusia ni, Epiphyas postvittana



ABOUT THIS RECORD

ID: MNEST035545
species: Bombyx mori
miRNA family: mir-263
source: miRBase, original name: bmo-mir-263a (MI0004978)

Taxonomy by NCBI:
Bombyx mori Bombyx Bombycinae Bombycidae Bombyciformes Bombycoidea Obtectomera Ditrysia Heteroneura Neolepidoptera Glossata Lepidoptera Amphiesmenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AATGGCACTGGAAGAATTCAC

miRNA*
GATCTCTTAGTGGCATCAC

mismatches: 4
bulges: 2

View larger
pre-miRNA
CATCGATCCAAGCACAGGCAATGGCACTGGAAGAATTCACGGGTTCAGTTTATATATTCCCGTGATCTCTTAGTGGCATCACTGGTGCAGGACGAC

dot-bracket secondary structure
).(((.(((..((((.((..(((.(((((..(((..(((((((...............))))))))))..))))).)))..)).)))).)))))).


SIMILARITIES
miRBase dgr-mir-263a: 1.0E-9

PMRD no hits

microPC no hits
UniProt no hits

RFAM 3mir-263: 8.0E-45

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Northern, cloned, RT-PCR, Solexa

references

[1] Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"
[2] Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y, Insect Biochem Mol Biol. 38:1066-1071(2008)., "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
[3] Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
[4] Tong CZ, Jin YF, Zhang YZ, J Zhejiang Univ Sci B. 7:806-816(2006)., "Computational prediction of microRNA genes in silkworm genome"
[5] He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori"




Liczniki na strone;