miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Bicyclus anynana, Bombyx mori, Spodoptera frugiperda, Heliothis virescens, Antheraea assama, Spodoptera littoralis, Samia cynthia ricini, Danaus plexippus, Papilio xuthus, Ostrinia nubilalis, Trichoplusia ni



ABOUT THIS RECORD

ID: MNEST035545
species: Bombyx mori
miRNA family: mir-263
source: miRBase, original name: bmo-mir-263a (MI0004978)

Taxonomy by NCBI:
Bombyx mori Bombyx Bombycinae Bombycidae Bombyciformes Bombycoidea Obtectomera Ditrysia Heteroneura Neolepidoptera Glossata Lepidoptera Amphiesmenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AATGGCACTGGAAGAATTCAC

miRNA*
GATCTCTTAGTGGCATCAC

mismatches: 4
bulges: 2

View larger
pre-miRNA
ATCGATCCAAGCACAGGCAATGGCACTGGAAGAATTCACGGGTTCAGTTTATATATTCCCGTGATCTCTTAGTGGCATCACTGGTGCAGGACGAC

dot-bracket secondary structure
.(((.(((..((((.((..(((.(((((..(((..(((((((...............))))))))))..))))).)))..)).)))).)))))).


SIMILARITIES
miRBase dgr-mir-263a: 0.000000001

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-263: 8e-45

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Northern, cloned, RT-PCR, Solexa

references

[1] Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"
[2] Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y, Insect Biochem Mol Biol. 38:1066-1071(2008)., "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
[3] Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
[4] Tong CZ, Jin YF, Zhang YZ, J Zhejiang Univ Sci B. 7:806-816(2006)., "Computational prediction of microRNA genes in silkworm genome"
[5] He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori"




Liczniki na strone;