miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Drosophila melanogaster, Drosophila simulans, Drosophila sechellia, Drosophila auraria, Drosophila pseudoobscura, Drosophila willistoni, Drosophila ananassae, Drosophila virilis, Drosophila erecta, Drosophila grimshawi, Drosophila mojavensis, Drosophila yakuba



ABOUT THIS RECORD

ID: MNEST036315
species: Drosophila melanogaster
miRNA family: bantam
source: miRBase, original name: dme-bantam (MI0000387)

Taxonomy by NCBI:
Drosophila melanogaster melanogaster subgroup melanogaster group Sophophora Drosophila Drosophiliti Drosophilina Drosophilini Drosophilinae Drosophilidae Ephydroidea Acalyptratae Schizophora Cyclorrhapha Eremoneura Muscomorpha Brachycera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CCGGTTTTCGATTTGGTTTGACT

miRNA*
TGAGATCATTTTGAAAGCTGATT

mismatches: 4
bulges: 0

View larger
pre-miRNA
ATTTGACTACGAAACCGGTTTTCGATTTGGTTTGACTGTTTTTCATACAAGTGAGATCATTTTGAAAGCTGATTTTGTCAA

dot-bracket secondary structure
..(((((...((((.((((((((((..((((((.(((((.......)).))).))))))..)))))))))).)))))))))


SIMILARITIES
miRBase der-bantam: 9e-41

PMRD no hits

microPC no hits
UniProt no hits

RFAM bantam: 4e-37

Identical with: dya-bantam from miRBase (MNEST037478)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record

references

[1] Moberg KH, Hariharan IK, Trends Cell Biol. 13:455-457(2003)., "Big things from a little RNA"
[2] Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM, Cell. 113:25-36(2003)., "bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila"
[3] Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes"
[4] Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[5] Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[6] Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"




Liczniki na strone;