miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Drosophila melanogaster, Drosophila simulans, Drosophila sechellia, Drosophila auraria, Drosophila pseudoobscura, Drosophila willistoni, Drosophila ananassae, Drosophila virilis, Drosophila erecta, Drosophila grimshawi, Drosophila mojavensis, Drosophila yakuba



ABOUT THIS RECORD

ID: MNEST036354
species: Drosophila melanogaster
miRNA family: mir-10
source: miRBase, original name: dme-mir-10 (MI0000130)

Taxonomy by NCBI:
Drosophila melanogaster melanogaster subgroup melanogaster group Sophophora Drosophila Drosophiliti Drosophilina Drosophilini Drosophilinae Drosophilidae Ephydroidea Acalyptratae Schizophora Cyclorrhapha Eremoneura Muscomorpha Brachycera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
CAAATTCGGTTCTAGAGAGGTTT

miRNA*
ACCCTGTAGATCCGAATTTGTT

mismatches: 4
bulges: 1

View larger
pre-miRNA
CCACGTCTACCCTGTAGATCCGAATTTGTTTTATACTAGCTTTAAGGACAAATTCGGTTCTAGAGAGGTTTGTGTGG

dot-bracket secondary structure
(((((...(((((.((((.(((((((((((((............))))))))))))).)))).)).)))...)))))


SIMILARITIES
miRBase dme-mir-10: 2e-38

PMRD no hits

microPC no hits
UniProt no hits

RFAM mir-10: 9e-32

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, 454

references

[1] Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[2] Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V, Dev Biol. 259:9-18(2003)., "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity"
[3] Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[4] Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
[5] Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"




Liczniki na strone;