ABOUT THIS RECORD

ID: MNEST036400
species: Drosophila melanogaster
miRNA family: mir-210
source: miRBase, original name: dme-mir-210 (MI0000376)

Taxonomy by NCBI:
Drosophila melanogaster melanogaster subgroup melanogaster group Sophophora Drosophila Drosophiliti Drosophilina Drosophilini Drosophilinae Drosophilidae Ephydroidea Acalyptratae Schizophora Cyclorrhapha Eremoneura Muscomorpha Brachycera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE

pre-miRNA
AAAGGTGCTTATTGCAGCTGCTGGCCACTGCACAAGATTAGACTTAAGACTCTTGTGCGTGTGACAGCGGCTATTGTAAGAGGCCATAGAAGCAACAGCC


dot-bracket secondary structure
...(((.(((((...((((((((..((((((((((((.............))))))))).))).))))))))...)))))..)))......((....)).



SIMILARITIES

miRBase dme-mir-210: 5e-52 PMRD no hits microPC no hits

UniProt no hits RFAM mir-210: 5e-34

Identical with: der-mir-210 from miRBase (MNEST036189)

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, 454, Solexa

references
[1] Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes"
[2] Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[3] Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[4] Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"