miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Drosophila melanogaster, Drosophila simulans, Drosophila sechellia, Drosophila auraria, Drosophila pseudoobscura, Teleopsis dalmanni, Drosophila willistoni, Drosophila ananassae, Drosophila virilis, Drosophila erecta, Drosophila grimshawi, Ceratitis capitata, Drosophila mojavensis, Drosophila yakuba



ABOUT THIS RECORD

ID: MNEST036418
species: Drosophila melanogaster
miRNA family: mir-277
source: miRBase, original name: dme-mir-277 (MI0000360)

Taxonomy by NCBI:
Drosophila melanogaster melanogaster subgroup melanogaster group Sophophora Drosophila Drosophiliti Drosophilina Drosophilini Drosophilinae Drosophilidae Ephydroidea Acalyptratae Schizophora Cyclorrhapha Eremoneura Muscomorpha Brachycera Diptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TAAATGCACTATCTGGTACGACA

miRNA*
CGTGTCAGGAGTGCATTTGCA

mismatches: 2
bulges: 2

View larger
pre-miRNA
TTTGAAGGTTTTGGGCTGCGTGTCAGGAGTGCATTTGCACTGAAACTATCTGAAGCATGTAAATGCACTATCTGGTACGACATTCCAGAACGTACAATCTT


dot-bracket secondary structure
)(((.(.(((((((..(((((..((((((((((((((((.((...(.....)...)))))))))))))).))))..))).))..))))))).).)))....



SIMILARITIES
miRBase dme-mir-277: 5.0E-52

PMRD no hits

microPC no hits
UniProt no hits

RFAM 7mir-277: 8.0E-36

Identical with: der-mir-277 from miRBase (MNEST036197), dse-mir-277 from miRBase , dya-mir-277 from miRBase

MORE

miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Northern, cloned, 454, Solexa

references

[1] Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes"
[2] Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[3] Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[4] Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
[5] Stark A, Brennecke J, Russell RB, Cohen SM, PLoS Biol. 1:E60(2003)., "Identification of Drosophila MicroRNA targets"




Liczniki na strone;