ABOUT THIS RECORDspecies: Caenorhabditis elegans
miRNA family: lin-4
source: miRBase, original name: cel-lin-4 (MI0000002)
Taxonomy by NCBI:
Caenorhabditis elegans Caenorhabditis Peloderinae Rhabditidae Rhabditoidea Rhabditida Chromadorea Nematoda Pseudocoelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TCCCTGAGACCTCAAGTGTGA miRNA* ACACCTGGGCTCTCCGGGTAC mismatches: 4 bulges: 0 |
pre-miRNA
ATGCTTCCGGCCTGTTCCCTGAGACCTCAAGTGTGAGTGTACTATTGATGCTTCACACCTGGGCTCTCCGGGTACCAGGACGGTTTGAGCAGAT
dot-bracket secondary structure
.((((((((.((((..(((.((((.((((.(((((((.((((....).)))))))))).)))).)))).)))...)))).)))...)))))...
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Solexa, CLIPseq
deep sequencing data evidence
references
[1] Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"
[2] Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP, Genes Dev. 17:991-1008(2003)., "The microRNAs of Caenorhabditis elegans"
[3] Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[4] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[5] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[6] Olsen PH, Ambros V, Dev Biol. 216:671-680(1999)., "The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation"
[7] Lau NC, Lim LP, Weinstein EG, Bartel DP, Science. 294:858-862(2001)., "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
ATGCTTCCGGCCTGTTCCCTGAGACCTCAAGTGTGAGTGTACTATTGATGCTTCACACCTGGGCTCTCCGGGTACCAGGACGGTTTGAGCAGAT
dot-bracket secondary structure
.((((((((.((((..(((.((((.((((.(((((((.((((....).)))))))))).)))).)))).)))...)))).)))...)))))...
SIMILARITIES| miRBase crm-lin-4: 9e-29 PMRD no hits microPC no hits | UniProt no hits RFAM lin-4: 2e-18 |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Solexa, CLIPseq
deep sequencing data evidence
references
[1] Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"
[2] Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP, Genes Dev. 17:991-1008(2003)., "The microRNAs of Caenorhabditis elegans"
[3] Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[4] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[5] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[6] Olsen PH, Ambros V, Dev Biol. 216:671-680(1999)., "The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation"
[7] Lau NC, Lim LP, Weinstein EG, Bartel DP, Science. 294:858-862(2001)., "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
