ABOUT THIS RECORDspecies: Caenorhabditis elegans
miRNA family: mir-1
source: miRBase, original name: cel-mir-1 (MI0000003)
Taxonomy by NCBI:
Caenorhabditis elegans Caenorhabditis Peloderinae Rhabditidae Rhabditoidea Rhabditida Chromadorea Nematoda Pseudocoelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TGGAATGTAAAGAAGTATGTA miRNA* CATACTTCCTTACATGCCCATA mismatches: 2 bulges: 1 |
pre-miRNA
AAAGTGACCGTACCGAGCTGCATACTTCCTTACATGCCCATACTATATCATAAATGGATATGGAATGTAAAGAAGTATGTAGAACGGGGTGGTAGT
dot-bracket secondary structure
......((((..(((..(((((((((((.((((((..(((((((((.......)))).))))).)))))).)))))))))))..)))..))))...
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, Solexa
deep sequencing data evidence
references
[1] Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"
[2] Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"
[3] Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"
[4] Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP, Genes Dev. 17:991-1008(2003)., "The microRNAs of Caenorhabditis elegans"
[5] Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[6] Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs"
[7] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[8] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[9] Lee RC, Ambros V, Science. 294:862-864(2001)., "An extensive class of small RNAs in Caenorhabditis elegans"
[10] Lau NC, Lim LP, Weinstein EG, Bartel DP, Science. 294:858-862(2001)., "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
AAAGTGACCGTACCGAGCTGCATACTTCCTTACATGCCCATACTATATCATAAATGGATATGGAATGTAAAGAAGTATGTAGAACGGGGTGGTAGT
dot-bracket secondary structure
......((((..(((..(((((((((((.((((((..(((((((((.......)))).))))).)))))).)))))))))))..)))..))))...
SIMILARITIES| miRBase crm-mir-1: 3e-32 PMRD no hits microPC no hits | UniProt no hits RFAM mir-1: 5e-31 |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, Solexa
deep sequencing data evidence
references
[1] Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"
[2] Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"
[3] Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"
[4] Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP, Genes Dev. 17:991-1008(2003)., "The microRNAs of Caenorhabditis elegans"
[5] Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[6] Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J, Mol Cell. 11:1253-1263(2003)., "Computational and experimental identification of C. elegans microRNAs"
[7] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[8] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[9] Lee RC, Ambros V, Science. 294:862-864(2001)., "An extensive class of small RNAs in Caenorhabditis elegans"
[10] Lau NC, Lim LP, Weinstein EG, Bartel DP, Science. 294:858-862(2001)., "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
