miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Brassica napus, Brassica oleracea var. alboglabra, Brassica rapa, Raphanus raphanistrum, Raphanus raphanistrum subsp. landra, Raphanus raphanistrum subsp. maritimus, Raphanus sativus, Raphanus sativus var. oleiformis, Thellungiella halophila, Arabidopsis thaliana, Brassica oleracea



ABOUT THIS RECORD

ID: MNEST040017
species: Arabidopsis thaliana
miRNA family: MIR159
source: miRBase, original name: ath-MIR159b (MI0000218)

Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTTGGATTGAAGGGAGCTCTT

miRNA*
GAGCTCCTTGAAGTTCAATGG

mismatches: 3
bulges: 0

View larger
pre-miRNA
GGAAGAGCTCCTTGAAGTTCAATGGAGGGTTTAGCAGGGTGAAGTAAAGCTGCTAAGCTATGGATCCCATAAGCCTTATCAAATTCAATATAATTGATGA
TAAGGTTTTTTTTATGGATGCCATATCTCAGGAGCTTTCACTTACCCCTTTAATGGCTTCACTCTTCTTTGGATTGAAGGGAGCTCTTCATCTCTC


dot-bracket secondary structure
.((((((((((((..(((((((.(((((((..(((((((..((((((((((.((.((.(((((...(((((((((((((((...(((((...))))))))
)))))).....))))))...))))).)).)).)))))).))))..))))......)))..))))))).)))))))..)))))))))))).......



SIMILARITIES
miRBase aly-MIR159b: 2e-62

PMRD ath-miR159b: 1e-94

microPC miR159: 1e-20
UniProt no hits

RFAM MIR159: 2e-93

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, 5'RACE, 454, MPSS
deep sequencing data evidence

references

[1] Mette MF, van der Winden J, Matzke M, Matzke AJ, Plant Physiol. 130:6-9(2002)., "Short RNAs can identify new candidate transposable element families in Arabidopsis"
[2] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[3] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[4] Park W, Li J, Song R, Messing J, Chen X, Curr Biol. 12:1484-1495(2002)., "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana"
[5] Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"
[6] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[7] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"




Liczniki na strone;