miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Brassica napus, Brassica oleracea var. alboglabra, Brassica rapa, Raphanus raphanistrum, Raphanus raphanistrum subsp. landra, Raphanus raphanistrum subsp. maritimus, Raphanus sativus, Raphanus sativus var. oleiformis, Thellungiella halophila, Arabidopsis thaliana, Brassica oleracea



ABOUT THIS RECORD

ID: MNEST040022
species: Arabidopsis thaliana
miRNA family: MIR161
source: miRBase, original name: ath-MIR161 (MI0000193)

Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TCAATGCATTGAAAGTGACTA

miRNA*
GTCACTTTCACTGCATTAATC

mismatches: 2
bulges: 0

View larger
pre-miRNA
TGCTTGATCTCGGTTTTTGACCAGTTTATTGCGTCGATCAATGCATTGAAAGTGACTACATCGGGGTTCCGATTTTTTTTGTTCTTCATATGATGAAGCG
GAAACAGTAATCAACCCTGGTTTAGTCACTTTCACTGCATTAATCAATGCATTTGTAAAAAGAGGGAAAAGCA


dot-bracket secondary structure
.((((..((((..((((((..(((.....(((((.(((.((((((.((((((((((((.(((((((((..((((....(((((((((((...))))))..
..))))).))))))))))))).)))))))))))).)))))).))).))))).)))))))))..)))).)))).



SIMILARITIES
miRBase ath-MIR161: 6e-81

PMRD ath-miRf10691-akr: 3e-58

microPC miR161: 5e-38
UniProt no hits

RFAM no hits

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, PARE, Solexa
deep sequencing data evidence

references

[1] German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ, Nat Biotechnol. 26:941-946(2008)., "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends"
[2] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[3] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[4] Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"
[5] Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP, Genes Dev. 16:1616-1626(2002)., "MicroRNAs in plants"
[6] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[7] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"




Liczniki na strone;