miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Brassica napus, Brassica oleracea var. alboglabra, Brassica rapa, Citrus aurantium, Citrus reticulata, Citrus sinensis, Citrus unshiu, Eucalyptus globulus, Eucalyptus gunnii, Gossypium arboreum, Gossypium hirsutum, Gossypium raimondii, Limnanthes alba, Paullinia cupana var. sorbilis, Raphanus raphanistrum, Raphanus raphanistrum subsp. landra, Raphanus raphanistrum subsp. maritimus, Raphanus sativus, Raphanus sativus var. oleiformis, Thellungiella halophila, Theobroma cacao, Tropaeolum majus, Carica papaya, Citrus clementina, Arabidopsis thaliana, Brassica oleracea



ABOUT THIS RECORD

ID: MNEST040061
species: Arabidopsis thaliana
miRNA family: MIR171
source: miRBase, original name: ath-MIR171b (MI0000989)

Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTGAGCCGTGCCAATATCACG

miRNA*
AGATATTAGTGCGGTTCAATC

mismatches: 4
bulges: 0

View larger
pre-miRNA
TGCAAGGTAACGCGAGATATTAGTGCGGTTCAATCAAATAGTCGTCCTCTTAACTCATGGAGAACGGTGTTGTTCGATTGAGCCGTGCCAATATCACGCG
GTAAACCAAAAATGGCA


dot-bracket secondary structure
.....(((..((((.((((((.(..((((((((((.(((((((((.((((........)))).))))..))))).))))))))))..).)))))).))))
....)))..........



SIMILARITIES
miRBase aly-MIR171b: 3e-54

PMRD ath-miR171b: 5e-62

microPC miR171: 0.00000002
UniProt no hits

RFAM MIR171_1: 2e-49

Identical with: ath-miR171b from PMRD (MNEST046978)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
degradome data
download this record
evidence: cloned, Northern, 5'RACE, 454

references

[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Wang XJ, Reyes JL, Chua NH, Gaasterland T, Genome Biol. 5:R65(2004)., "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"
[3] Sunkar R, Zhu JK, Plant Cell. 16:2001-2019(2004)., "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
[4] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[5] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
[6] Jones-Rhoades MW, Bartel DP, Mol Cell. 14:787-799(2004)., "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"




Liczniki na strone;