miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse

Species belonging to selected taxon:

Arabidopsis thaliana



ABOUT THIS RECORD

ID: MNEST040064
species: Arabidopsis thaliana
miRNA family: MIR172
source: miRBase, original name: ath-MIR172b (MI0000216)

Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
AGAATCTTGATGATGCTGCAT

miRNA*
GCAGCACCATTAAGATTCACA

mismatches: 4
bulges: 0

View larger
pre-miRNA
AGGCGCAGCACCATTAAGATTCACATGGAAATTGATAAATACCCTAAATTAGGGTTTTGATATGTATATGAGAATCTTGATGATGCTGCATCAAC

dot-bracket secondary structure
.(..((((((.(((((((((((.((((...((...((((.((((((...))))))))))..))...)))).))))))))))).))))))..)...


SIMILARITIES
miRBase aly-MIR172b: 4e-37

PMRD ath-miRf10564-akr: 5e-49

microPC miR172: 0.0000003
UniProt no hits

RFAM mir-172: 9e-48

Identical with: ath-miR172b from PMRD (MNEST046984)

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, 5'RACE, 454, MPSS
deep sequencing data evidence

references

[1] Mette MF, van der Winden J, Matzke M, Matzke AJ, Plant Physiol. 130:6-9(2002)., "Short RNAs can identify new candidate transposable element families in Arabidopsis"
[2] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[3] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[4] Park W, Li J, Song R, Messing J, Chen X, Curr Biol. 12:1484-1495(2002)., "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana"
[5] Wang XJ, Reyes JL, Chua NH, Gaasterland T, Genome Biol. 5:R65(2004)., "Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"
[6] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[7] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"




Liczniki na strone;