ABOUT THIS RECORDspecies: Arabidopsis thaliana
miRNA family: MIR399
source: miRBase, original name: ath-MIR399c (MI0001022)
Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TGCCAAAGGAGAGTTGCCCTG miRNA* GGGCATCTTTCTATTGGCAGG mismatches: 2 bulges: 0 |
pre-miRNA
GGAGCAGTAATAGGGCATCTTTCTATTGGCAGGCGACTTGGCTATTTGTATCTTTTGTGTTCTTGACTATTGGCTATGTCACTTGCCAAAGGAGAGTTGC
CCTGTCACTGCTTC
dot-bracket secondary structure
((((((((.((((((((.((((((.((((((((.(((.((((((...((................))...)))))).))).)))))))).)))))).)))
))))).))))))))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: PCR, cloned, 5'RACE, 454
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[3] Sunkar R, Zhu JK, Plant Cell. 16:2001-2019(2004)., "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
[4] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[5] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
[6] Jones-Rhoades MW, Bartel DP, Mol Cell. 14:787-799(2004)., "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
GGAGCAGTAATAGGGCATCTTTCTATTGGCAGGCGACTTGGCTATTTGTATCTTTTGTGTTCTTGACTATTGGCTATGTCACTTGCCAAAGGAGAGTTGC
CCTGTCACTGCTTC
dot-bracket secondary structure
((((((((.((((((((.((((((.((((((((.(((.((((((...((................))...)))))).))).)))))))).)))))).)))
))))).))))))))
SIMILARITIES| miRBase aly-MIR399c: 1e-50 PMRD ath-miR399c: 3e-60 microPC miR399: 0.000006 | UniProt no hits RFAM mir-399: 5e-59 |
Identical with: ath-miR399c from PMRD (MNEST047017) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: PCR, cloned, 5'RACE, 454
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[3] Sunkar R, Zhu JK, Plant Cell. 16:2001-2019(2004)., "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"
[4] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[5] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
[6] Jones-Rhoades MW, Bartel DP, Mol Cell. 14:787-799(2004)., "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
