ABOUT THIS RECORDspecies: Homo sapiens
miRNA family: mir-25
source: miRBase, original name: hsa-mir-92a-1 (MI0000093)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TATTGCACTTGTCCCGGCCTGT miRNA* AGGTTGGGATCGGTTGCAATGCT mismatches: 1 bulges: 1 |
pre-miRNA
CTTTCTACACAGGTTGGGATCGGTTGCAATGCTGTGTTTCTGTATGGTATTGCACTTGTCCCGGCCTGTTGAGTTTGG
dot-bracket secondary structure
..(((...((((((((((((.(((.(((((((((((......)))))))))))))).)))))))))))).))).....
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern
deep sequencing data evidence
references
[1] Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"
[2] Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
[3] Houbaviy HB, Murray MF, Sharp PA, Dev Cell. 5:351-358(2003)., "Embryonic stem cell-specific MicroRNAs"
[4] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[5] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[6] Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
[7] Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS, Dev Biol. 270:488-498(2004)., "Human embryonic stem cells express a unique set of microRNAs"
[8] Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs"
CTTTCTACACAGGTTGGGATCGGTTGCAATGCTGTGTTTCTGTATGGTATTGCACTTGTCCCGGCCTGTTGAGTTTGG
dot-bracket secondary structure
..(((...((((((((((((.(((.(((((((((((......)))))))))))))).)))))))))))).))).....
SIMILARITIES| miRBase age-mir-92-1: 5e-39 PMRD no hits microPC no hits | UniProt no hits RFAM mir-92: 3e-25 |
Identical with: ppa-mir-92-1 from miRBase (MNEST030073) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern
deep sequencing data evidence
references
[1] Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"
[2] Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
[3] Houbaviy HB, Murray MF, Sharp PA, Dev Cell. 5:351-358(2003)., "Embryonic stem cell-specific MicroRNAs"
[4] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[5] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[6] Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
[7] Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS, Dev Biol. 270:488-498(2004)., "Human embryonic stem cells express a unique set of microRNAs"
[8] Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs"
