ABOUT THIS RECORDspecies: Homo sapiens
miRNA family: mir-17
source: miRBase, original name: hsa-mir-106a (MI0000113)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA AAAAGTGCTTACAGTGCAGGTAG miRNA* ACTGCAATGTAAGCACTTCTTAC mismatches: 1 bulges: 2 |
pre-miRNA
CCTTGGCCATGTAAAAGTGCTTACAGTGCAGGTAGCTTTTTGAGATCTACTGCAATGTAAGCACTTCTTACATTACCATGG
dot-bracket secondary structure
((.(((..(((((((((((((((((.(((((.(((.((.....)).)))))))).))))))))))).))))))..))).))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned
references
[1] Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs"
CCTTGGCCATGTAAAAGTGCTTACAGTGCAGGTAGCTTTTTGAGATCTACTGCAATGTAAGCACTTCTTACATTACCATGG
dot-bracket secondary structure
((.(((..(((((((((((((((((.(((((.(((.((.....)).)))))))).))))))))))).))))))..))).))
SIMILARITIES| miRBase age-mir-106a: 2e-38 PMRD no hits microPC no hits | UniProt no hits RFAM mir-17: 6e-30 |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned
references
[1] Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs"
