ABOUT THIS RECORDspecies: Homo sapiens
miRNA family: mir-142
source: miRBase, original name: hsa-mir-142 (MI0000458)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA CATAAAGTAGAAAGCACTACT miRNA* TAGTGTTTCCTACTTTATGGA mismatches: 2 bulges: 0 |
pre-miRNA
GACAGTGCAGTCACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTGTAGTGTTTCCTACTTTATGGATGAGTGTACTGTG
dot-bracket secondary structure
.((((((((.(((.(((((((((((.(((((((((...(..(....)..)..))))))))).))))))))))).))).)))))))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned
references
[1] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[2] Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ, Mol Cancer Res. 1:882-891(2003)., "Reduced accumulation of specific microRNAs in colorectal neoplasia"
[3] Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
[4] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
GACAGTGCAGTCACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTGTAGTGTTTCCTACTTTATGGATGAGTGTACTGTG
dot-bracket secondary structure
.((((((((.(((.(((((((((((.(((((((((...(..(....)..)..))))))))).))))))))))).))).)))))))).
SIMILARITIES| miRBase mml-mir-142: 3e-44 PMRD no hits microPC no hits | UniProt no hits RFAM mir-142: 2e-42 |
Identical with: rno-mir-142 from miRBase (MNEST032747) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned
references
[1] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[2] Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ, Mol Cancer Res. 1:882-891(2003)., "Reduced accumulation of specific microRNAs in colorectal neoplasia"
[3] Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
[4] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
