ABOUT THIS RECORDspecies: Homo sapiens
miRNA family: mir-224
source: miRBase, original name: hsa-mir-224 (MI0000301)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA CAAGTCACTAGTGGTTCCGTT miRNA* TGGTGCCCTAGTGACTACAA mismatches: 3 bulges: 1 |
pre-miRNA
GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTGTGCATTGTTTCAAAATGGTGCCCTAGTGACTACAAAGCCC
dot-bracket secondary structure
(((((((..(((((((((.(((.((((((.(.(((..((.....))..)))).)))))).))))))))))))..)))))))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned
references
[1] Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G, J Virol. 83:3333-3341(2009)., "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
[2] Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs"
[3] Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E, PLoS One. 3:e3726(2008)., "MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells"
[4] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[5] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[6] Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs"
GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTGTGCATTGTTTCAAAATGGTGCCCTAGTGACTACAAAGCCC
dot-bracket secondary structure
(((((((..(((((((((.(((.((((((.(.(((..((.....))..)))).)))))).))))))))))))..)))))))
SIMILARITIES| miRBase mml-mir-224: 9e-41 PMRD no hits microPC no hits | UniProt no hits RFAM mir-224: 2e-32 |
Identical with: mml-mir-224 from miRBase (MNEST027822) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned
references
[1] Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G, J Virol. 83:3333-3341(2009)., "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas"
[2] Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs"
[3] Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E, PLoS One. 3:e3726(2008)., "MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells"
[4] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[5] Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[6] Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs"
