ABOUT THIS RECORDspecies: Homo sapiens
miRNA family: mir-154
source: miRBase, original name: hsa-mir-369 (MI0000777)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA AATAATACATGGTTGATCTTT miRNA* AGATCGACCGTGTTATATTCG mismatches: 2 bulges: 0 |
pre-miRNA
TTGAAGGGAGATCGACCGTGTTATATTCGCTTTATTGACTTCGAATAATACATGGTTGATCTTTTCTCAG
dot-bracket secondary structure
.(((..(((((((((((((((..((((((............))))))..)))))))))))))))..))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned
deep sequencing data evidence
references
[1] Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS, Dev Biol. 270:488-498(2004)., "Human embryonic stem cells express a unique set of microRNAs"
[4] Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"
TTGAAGGGAGATCGACCGTGTTATATTCGCTTTATTGACTTCGAATAATACATGGTTGATCTTTTCTCAG
dot-bracket secondary structure
.(((..(((((((((((((((..((((((............))))))..)))))))))))))))..))).
SIMILARITIES| miRBase mml-mir-369: 3e-34 PMRD no hits microPC no hits | UniProt no hits RFAM mir-154: 3e-25 |
Identical with: ppy-mir-369 from miRBase (MNEST030972) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned
deep sequencing data evidence
references
[1] Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS, Dev Biol. 270:488-498(2004)., "Human embryonic stem cells express a unique set of microRNAs"
[4] Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"
