ABOUT THIS RECORDspecies: Homo sapiens
miRNA family: mir-3065
source: miRBase, original name: hsa-mir-3065 (MI0014228)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TCAGCACCAGGATATTGTTGGAG miRNA* TCAACAAAATCACTGATGCTGGAG mismatches: 3 bulges: 1 |
pre-miRNA
GCTGCCCTCTTCAACAAAATCACTGATGCTGGAGTCGCCTGAGTCATCACTCAGCACCAGGATATTGTTGGAGAGGACAG
dot-bracket secondary structure
)(((.((((((((((((.(((.(((.(((((((.((....)).))......))))).)))))).)))))))))))).)))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa, 454
references
[1] Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK, PLoS One. 5:e9685(2010)., "Characterization of the Melanoma miRNAome by Deep Sequencing"
[2] Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
[3] Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E, Nucleic Acids Res. 38:6234-6246(2010)., "Discovery of microRNAs and other small RNAs in solid tumors"
GCTGCCCTCTTCAACAAAATCACTGATGCTGGAGTCGCCTGAGTCATCACTCAGCACCAGGATATTGTTGGAGAGGACAG
dot-bracket secondary structure
)(((.((((((((((((.(((.(((.(((((((.((....)).))......))))).)))))).)))))))))))).)))
SIMILARITIES| miRBase hsa-mir-3065: 1.0E-39 PMRD no hits microPC no hits | UniProt no hits RFAM 8mir-338: 8.0E-26 |
Identical with: ptr-mir-338 from miRBase (MNEST030334), hsa-mir-338 from miRBase |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa, 454
references
[1] Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK, PLoS One. 5:e9685(2010)., "Characterization of the Melanoma miRNAome by Deep Sequencing"
[2] Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
[3] Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E, Nucleic Acids Res. 38:6234-6246(2010)., "Discovery of microRNAs and other small RNAs in solid tumors"
