ABOUT THIS RECORDspecies: Homo sapiens
source: miRBase, original name: hsa-mir-3679 (MI0016080)
Taxonomy by NCBI:
Homo sapiens Homo Homininae Hominidae Hominoidea Catarrhini Simiiformes Haplorrhini Primates Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA CTTCCCCCCAGTAATCTTCATC miRNA* TGAGGATATGGCAGGGAAGGG mismatches: 2 bulges: 3 |
pre-miRNA
CGTGGTGAGGATATGGCAGGGAAGGGGAGTTTCCCTCTATTCCCTTCCCCCCAGTAATCTTCATCATG
dot-bracket secondary structure
((((((((((((.(((..((((((((((...........)))))))))).)))...))))))))))))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
references
[1] Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH, PLoS One. 5:e9637(2010)., "Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
[2] Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
[3] Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood"
CGTGGTGAGGATATGGCAGGGAAGGGGAGTTTCCCTCTATTCCCTTCCCCCCAGTAATCTTCATCATG
dot-bracket secondary structure
((((((((((((.(((..((((((((((...........)))))))))).)))...))))))))))))
SIMILARITIES| miRBase hsa-mir-3679: 4e-33 PMRD no hits microPC no hits | UniProt no hits RFAM no hits |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
references
[1] Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH, PLoS One. 5:e9637(2010)., "Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
[2] Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
[3] Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood"
