ABOUT THIS RECORDspecies: Mus musculus
miRNA family: mir-134
source: miRBase, original name: mmu-mir-134 (MI0000160)
Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TGTGACTGGTTGACCAGAGGGG miRNA* CCTGTGGGCCACCTAGTCACCAA mismatches: 5 bulges: 1 |
pre-miRNA
AGGGTGTGTGACTGGTTGACCAGAGGGGCGTGCACTCTGTTCACCCTGTGGGCCACCTAGTCACCAACCCT
dot-bracket secondary structure
(((((..((((((((.((.(((.((((....((.....))...)))).)))..)).))))))))..)))))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, PCR, Solexa
deep sequencing data evidence
references
[1] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
[4] Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J, Genome Res. 14:1741-1748(2004)., "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
[5] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
[6] Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M, Nature. 432:226-230(2004)., "A pancreatic islet-specific microRNA regulates insulin secretion"
[7] Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
AGGGTGTGTGACTGGTTGACCAGAGGGGCGTGCACTCTGTTCACCCTGTGGGCCACCTAGTCACCAACCCT
dot-bracket secondary structure
(((((..((((((((.((.(((.((((....((.....))...)))).)))..)).))))))))..)))))
SIMILARITIES| miRBase mml-mir-134: 2e-32 PMRD no hits microPC no hits | UniProt no hits RFAM mir-134: 5e-24 |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, PCR, Solexa
deep sequencing data evidence
references
[1] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
[4] Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J, Genome Res. 14:1741-1748(2004)., "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
[5] Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
[6] Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M, Nature. 432:226-230(2004)., "A pancreatic islet-specific microRNA regulates insulin secretion"
[7] Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
