miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



ABOUT THIS RECORD

ID: MNEST032029
species: Mus musculus
miRNA family: mir-350
source: miRBase, original name: mmu-mir-350 (MI0000640)

Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms






SEQUENCE & STRUCTURE
miRNA
TTCACAAAGCCCATACACTTTC

miRNA*
AAGTGCATGCGCTTTGGGACA

mismatches: 3
bulges: 1

View larger
pre-miRNA
GAGATGCCTTGCTCCTACAAGAGTAAAGTGCATGCGCTTTGGGACAGTGAGGAAAATAATGTTCACAAAGCCCATACACTTTCACCCTTTAGGAGAGTTG

dot-bracket secondary structure
)..........((((((.(((.((((((((.(((.(((((((((((.............))))).)))))).))).)))))).)).))))))))).....


SIMILARITIES
miRBase rno-mir-350: 1.0E-46

PMRD no hits

microPC no hits
UniProt no hits

RFAM 0mir-350: 8.0E-39

MORE

miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Solexa

references

[1] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
[4] Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
[5] Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M, Nature. 432:226-230(2004)., "A pancreatic islet-specific microRNA regulates insulin secretion"
[6] Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"




Liczniki na strone;