ABOUT THIS RECORDspecies: Mus musculus
miRNA family: miR-466h
source: miRBase, original name: mmu-mir-466h (MI0005511)
Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TACGCACGCACACACACAC miRNA* GTGCATGTGCTTGTGTGTATG mismatches: 2 bulges: 2 |
pre-miRNA
TGTATATTTGTGTGTGCATGTGCTTGTGTGTATGTGAATATATATATCATACGCACGCACACACACACACAAATGCAAGCA
dot-bracket secondary structure
....((((((((((((..(((((..(((((((((.............))))))))))))))..))))))))))))......
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: 454, Solexa
references
[1] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Calabrese JM, Seila AC, Yeo GW, Sharp PA, Proc Natl Acad Sci U S A. 104:18097-18102(2007)., "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
[4] Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
TGTATATTTGTGTGTGCATGTGCTTGTGTGTATGTGAATATATATATCATACGCACGCACACACACACACAAATGCAAGCA
dot-bracket secondary structure
....((((((((((((..(((((..(((((((((.............))))))))))))))..))))))))))))......
SIMILARITIES| miRBase no hits PMRD no hits microPC no hits | UniProt no hits RFAM no hits |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: 454, Solexa
references
[1] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
[2] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3] Calabrese JM, Seila AC, Yeo GW, Sharp PA, Proc Natl Acad Sci U S A. 104:18097-18102(2007)., "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
[4] Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
