ABOUT THIS RECORDspecies: Mus musculus
miRNA family: mir-1843
source: miRBase, original name: mmu-mir-1843 (MI0004155)
Taxonomy by NCBI:
Mus musculus Mus Mus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TATGGAGGTCTCTGTCTGACT miRNA* TCTGATCGTTCACCTCCATACA mismatches: 4 bulges: 1 |
pre-miRNA
GAATATGGAGGTCTCTGTCTGACTTAGAATAGCTGGCTGAGTCTGATCGTTCACCTCCATACAAC
dot-bracket secondary structure
...(((((((((..(.(((.(((((((.........))))))).))).)...)))))))))....
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
references
[1] Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E, Genome Res. 16:1289-1298(2006)., "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
[2] Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER, Genome Res. 20:1590-1604(2010)., "Next-generation sequencing identifies the natural killer cell microRNA transcriptome"
[3] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
GAATATGGAGGTCTCTGTCTGACTTAGAATAGCTGGCTGAGTCTGATCGTTCACCTCCATACAAC
dot-bracket secondary structure
...(((((((((..(.(((.(((((((.........))))))).))).)...)))))))))....
SIMILARITIES| miRBase mmu-mir-1843: 2e-31 PMRD no hits microPC no hits | UniProt no hits RFAM SCARNA3: 2e-29 |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
references
[1] Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E, Genome Res. 16:1289-1298(2006)., "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
[2] Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER, Genome Res. 20:1590-1604(2010)., "Next-generation sequencing identifies the natural killer cell microRNA transcriptome"
[3] Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
