ABOUT THIS RECORDspecies: Rattus norvegicus
miRNA family: mir-29
source: miRBase, original name: rno-mir-29c (MI0000865)
Taxonomy by NCBI:
Rattus norvegicus Rattus Murinae Muridae Muroidea Sciurognathi Rodentia Glires Euarchontoglires Eutheria Theria Mammalia Amniota Tetrapoda Sarcopterygii Euteleostomi Teleostomi Gnathostomata Vertebrata Craniata Chordata Deuterostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TAGCACCATTTGAAATCGGTTA miRNA* ACCGATTTCTCCTGGTGTTCAG mismatches: 4 bulges: 0 |
pre-miRNA
ATCTCTTACACAGGCTGACCGATTTCTCCTGGTGTTCAGAGTCTGTTTTTGTCTAGCACCATTTGAAATCGGTTATGATGTAGGGGGA
dot-bracket secondary structure
.(((((((((((...(((((((((((...((((((((((((.....)))))...)))))))...))))))))))))).))))))))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, SOLiD
references
[1] Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR, Genome Biol. 5:R68(2004)., "Microarray analysis of microRNA expression in the developing mammalian brain"
[2] Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"
[3] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[4] He X, Zhang Q, Liu Y, Pan X, Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007)., "Cloning and identification of novel microRNAs from rat hippocampus"
[5] Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
ATCTCTTACACAGGCTGACCGATTTCTCCTGGTGTTCAGAGTCTGTTTTTGTCTAGCACCATTTGAAATCGGTTATGATGTAGGGGGA
dot-bracket secondary structure
.(((((((((((...(((((((((((...((((((((((((.....)))))...)))))))...))))))))))))).))))))))).
SIMILARITIES| miRBase eca-mir-29c: 7e-45 PMRD no hits microPC no hits | UniProt no hits RFAM mir-29: 5e-18 |
Identical with: eca-mir-29c from miRBase (MNEST026973) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, SOLiD
references
[1] Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR, Genome Biol. 5:R68(2004)., "Microarray analysis of microRNA expression in the developing mammalian brain"
[2] Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"
[3] Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[4] He X, Zhang Q, Liu Y, Pan X, Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007)., "Cloning and identification of novel microRNAs from rat hippocampus"
[5] Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
