ABOUT THIS RECORDspecies: Bombyx mori
miRNA family: mir-275
source: miRBase, original name: bmo-mir-275 (MI0004979)
Taxonomy by NCBI:
Bombyx mori Bombyx Bombycinae Bombycidae Bombyciformes Bombycoidea Obtectomera Ditrysia Heteroneura Neolepidoptera Glossata Lepidoptera Amphiesmenoptera Endopterygota Neoptera Pterygota Dicondylia Insecta Hexapoda Pancrustacea Mandibulata Arthropoda Panarthropoda Protostomia Coelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TCAGGTACCTGAAGTAGCGCGCG miRNA* CGCGCTACTCCGGCGCCAGGACT mismatches: 4 bulges: 2 |
pre-miRNA
CAGGCGGCAGCGCCGCGCGCTACTCCGGCGCCAGGACTGTCCTCACCGAGTCAGGTACCTGAAGTAGCGCGCGGTGTCTCCTCCTA
dot-bracket secondary structure
.(((.((..((((((((((((((((.((..((..((((..........)))).))..)).).)))))))))))))))..)).))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, RT-PCR, Solexa
references
[1] Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"
[2] Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y, Insect Biochem Mol Biol. 38:1066-1071(2008)., "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
[3] Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
[4] Tong CZ, Jin YF, Zhang YZ, J Zhejiang Univ Sci B. 7:806-816(2006)., "Computational prediction of microRNA genes in silkworm genome"
[5] He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori"
CAGGCGGCAGCGCCGCGCGCTACTCCGGCGCCAGGACTGTCCTCACCGAGTCAGGTACCTGAAGTAGCGCGCGGTGTCTCCTCCTA
dot-bracket secondary structure
.(((.((..((((((((((((((((.((..((..((((..........)))).))..)).).)))))))))))))))..)).))).
SIMILARITIES| miRBase dpu-mir-275: 0.000000004 PMRD no hits microPC no hits | UniProt no hits RFAM mir-275: 7e-42 |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, RT-PCR, Solexa
references
[1] Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"
[2] Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y, Insect Biochem Mol Biol. 38:1066-1071(2008)., "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
[3] Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
[4] Tong CZ, Jin YF, Zhang YZ, J Zhejiang Univ Sci B. 7:806-816(2006)., "Computational prediction of microRNA genes in silkworm genome"
[5] He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y, BMC Genomics. 9:248(2008)., "Identification and characteristics of microRNAs from Bombyx mori"
