ABOUT THIS RECORDspecies: Caenorhabditis elegans
miRNA family: mir-259
source: miRBase, original name: cel-mir-259 (MI0000336)
Taxonomy by NCBI:
Caenorhabditis elegans Caenorhabditis Peloderinae Rhabditidae Rhabditoidea Rhabditida Chromadorea Nematoda Pseudocoelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA AAATCTCATCCTAATCTGGTAG miRNA* ACCGATTTGGCATGGGATTGAC mismatches: 3 bulges: 2 |
pre-miRNA
TCAGTCATTGAAACGAGTAAATCTCATCCTAATCTGGTAGCATCTTTCGAACCTTGCCACCGATTTGGCATGGGATTGACTTGTTAAATAGTGACTTTTT
T
dot-bracket secondary structure
..((((((((.(((((((.((((((((((.((((.(((.(((............))).))))))).)).)))))))).)))))))...))))))))....
.
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Solexa, CLIPseq
references
[1] Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"
[2] Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB, RNA. 10:1309-1322(2004)., "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification"
[3] Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"
[4] Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[5] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[6] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
TCAGTCATTGAAACGAGTAAATCTCATCCTAATCTGGTAGCATCTTTCGAACCTTGCCACCGATTTGGCATGGGATTGACTTGTTAAATAGTGACTTTTT
T
dot-bracket secondary structure
..((((((((.(((((((.((((((((((.((((.(((.(((............))).))))))).)).)))))))).)))))))...))))))))....
.
SIMILARITIES| miRBase cbr-mir-259: 0.000000000005 PMRD no hits microPC no hits | UniProt no hits RFAM mir-259: 2e-51 |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Solexa, CLIPseq
references
[1] Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"
[2] Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB, RNA. 10:1309-1322(2004)., "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification"
[3] Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D, Curr Biol. 13:807-818(2003)., "MicroRNAs and other tiny endogenous RNAs in C. elegans"
[4] Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP, Cell. 127:1193-1207(2006)., "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
[5] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[6] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
