ABOUT THIS RECORDspecies: Caenorhabditis elegans
source: miRBase, original name: cel-mir-1824 (MI0007986)
Taxonomy by NCBI:
Caenorhabditis elegans Caenorhabditis Peloderinae Rhabditidae Rhabditoidea Rhabditida Chromadorea Nematoda Pseudocoelomata Bilateria Eumetazoa Metazoa Fungi/Metazoa group Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA GTTGGCCGTGGTGAACACTTCCGCC miRNA* TGGCAGTGTTTCTCCCCCAACTT mismatches: 3 bulges: 4 |
pre-miRNA
GTTCACCAGAGTTGGCAGTGTTTCTCCCCCAACTTTTGTTACAGAATTGCAAAAATGTTGGCCGTGGTGAACACTTCCGCCTCTGGTTTGAAG
dot-bracket secondary structure
.((((((((((.(((.(((((((..((((((((((((((.........))))))..)))))..).)).))))))).))).)))))))..))).
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
references
[1] Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"
[2] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[3] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[4] Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M, Mol Cell. 28:598-613(2007)., "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2"
GTTCACCAGAGTTGGCAGTGTTTCTCCCCCAACTTTTGTTACAGAATTGCAAAAATGTTGGCCGTGGTGAACACTTCCGCCTCTGGTTTGAAG
dot-bracket secondary structure
.((((((((((.(((.(((((((..((((((((((((((.........))))))..)))))..).)).))))))).))).)))))))..))).
SIMILARITIES| miRBase cel-mir-1824: 7e-48 PMRD no hits microPC no hits | UniProt no hits RFAM no hits |
MOREmiRNEST target predictions: none
non-miRNEST targets: none
HuntMi prediction: true miRNA
additional data
download this record
evidence: Solexa
references
[1] Warf MB, Johnson WE, Bass BL, RNA. 17:563-577(2011)., "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer"
[2] Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
[3] Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[4] Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M, Mol Cell. 28:598-613(2007)., "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2"
