ABOUT THIS RECORDspecies: Arabidopsis thaliana
miRNA family: MIR160
source: miRBase, original name: ath-MIR160c (MI0000192)
Taxonomy by NCBI:
Arabidopsis thaliana Arabidopsis Brassicaceae Brassicales malvids rosids core eudicotyledons eudicotyledons Magnoliophyta Spermatophyta Euphyllophyta Tracheophyta Embryophyta Streptophytina Streptophyta Viridiplantae Eukaryota cellular organisms
SEQUENCE & STRUCTURE| miRNA TGCCTGGCTCCCTGTATGCCA miRNA* GCGTACAAGGAGTCAAGCATG mismatches: 2 bulges: 0 |
pre-miRNA
GTTATGCCTGGCTCCCTGTATGCCACGAGTGGATACCGATTTTGGTTTTAAAATCGGCTGCCGGTGGCGTACAAGGAGTCAAGCATGAC
dot-bracket secondary structure
(((((((.(((((((.((((((((((..(..(...(((((((((....))))))))))..)..)))))))))).))))))).)))))))
SIMILARITIES
MORE
miRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, 5'RACE, 454
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[3] Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"
[4] Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP, Genes Dev. 16:1616-1626(2002)., "MicroRNAs in plants"
[5] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[6] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
GTTATGCCTGGCTCCCTGTATGCCACGAGTGGATACCGATTTTGGTTTTAAAATCGGCTGCCGGTGGCGTACAAGGAGTCAAGCATGAC
dot-bracket secondary structure
(((((((.(((((((.((((((((((..(..(...(((((((((....))))))))))..)..)))))))))).))))))).)))))))
SIMILARITIES| miRBase aly-MIR160c: 6e-36 PMRD ath-miR160c: 2e-45 microPC miR160: 2e-39 | UniProt no hits RFAM mir-160: 5e-43 |
Identical with: miR160 from microPC (MNEST044804) |
MOREmiRNEST target predictions: none
non-miRNEST targets
HuntMi prediction: true miRNA
additional data
download this record
evidence: cloned, Northern, 5'RACE, 454
deep sequencing data evidence
references
[1] Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
[2] Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW, J Exp Bot. 61:165-177(2010)., "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
[3] Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"
[4] Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP, Genes Dev. 16:1616-1626(2002)., "MicroRNAs in plants"
[5] Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
[6] Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"
